Informacja

Wyjaśnienie zapisu metody w metodzie hodowli drożdży

Wyjaśnienie zapisu metody w metodzie hodowli drożdży


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Czytam artykuł o hodowli drożdży i metodach, mówi:

Następnie $5$ ml sterylnego 15 USD KH_2PO_4$, został dodany do skosu,

Jakie jest znaczenie $M/15$?


Penicillium: opis, struktura i reprodukcja

Penicillium to saprofityczny grzyb, powszechnie znany jako niebieska lub zielona pleśń. Według Rapera i Thoma (1949) rodzaj obejmuje 136 gatunków rozsianych po całym świecie. Występują w glebie, powietrzu, na rozkładających się owocach, warzywach, mięsie itp.

„Cudowny lek” penicylina został po raz pierwszy odkryty przez Sir Alexandra Fleminga w Sant Mary’s Hospital w Londynie w 1929 roku podczas jego pracy z bakterią Staphylococcus aureus odpowiedzialną za czyraki, karbunkuły, posocznicę w ranach i oparzeniach itp. z zarodnikami pleśni (Penicillium notatum), które po prawidłowym wzroście powodują śmierć 5. aureus ukazując wokół siebie strefę lityczną.

Wyizolował i nazwał ten przeciwbakteryjny związek penicyliną. Później Raper i Alexander (1945) wyselekcjonowali szczep P. crysogenum, bardziej wydajny niż P. notatum w produkcji penicyliny. Znaczenie Penicillium przedstawiono w Tabeli 4.6.

Struktura wegetatywna Penicillium:

Ciało wegetatywne to grzybnia (ryc. 4.42A, B). Grzybnia jest obficie rozgałęziona ze strzępkami przegrodowymi, składającymi się z cienkościennych komórek zawierających od jednego do wielu jąder (ryc. 4.42C). Każda przegroda posiada centralny otwór, przez który zachowana jest ciągłość cyto-szplazmatyczna.

Niektóre grzybnie wrastają głębiej w podłoże, aby wchłonąć materiał pokarmowy, a inne pozostają na podłożu i wyrastają z filcu grzybni. Pokarm rezerwowy występuje w postaci kuleczek oleju.

Reprodukcja w Penicillium:

Penicillium rozmnaża się wegetatywnie, bezpłciowo i seksualnie.

1. Rozmnażanie wegetatywne:

Odbywa się to przez przypadkowe rozbicie grzybni wegetatywnej na dwa lub więcej fragmentów. Każdy fragment rośnie wtedy indywidualnie, jak grzybnia macierzysta.

2. Rozmnażanie bezpłciowe:

Rozmnażanie bezpłciowe odbywa się przez jednokomórkowe, jednojądrowe, nieruchome zarodniki, konidia utworzone na konidioforze (ryc. 4.43).

Konidiofor rozwija się jako wyprostowana gałąź z dowolnej komórki grzybni wegetatywnej. Konidiofor może być nierozgałęziony (P. spinulosum, P. thomii) lub może być rozgałęziony (P. expansum). Gałąź konidioforu (ryc. 4.44B) jest znana jako ramus (liczba mnoga rami), która dalej staje się rozgałęziona, znana jako metulae. Na końcu każdego metuli rozwija się pewna liczba fialid lub sterygmatów w kształcie kolby.

Każda sterigmata rozwija na swoim wierzchołku szereg konidiów ułożonych podstawkowo (młodsza przy matce, starsza z dala od niej). U gatunku (P. spinulosum) z nierozgałęzionym konidioforem sterigmata rozwija się na wierzchołku konidioforu. Rzadko (P. claviforme) wiele konidioforów agreguje się, tworząc maczugowaty owocnik zwany coremium, w którym rozwijają się konidia znane jako coremiospory.

Podczas rozwoju konidium wierzchołek sterigmy pęcznieje, a jej jądro dzieli się mitotycznie na dwa jądra, z których jedno migruje do nabrzmiałego wierzchołka i przez ściankę działową spuchnięty obszar odcina się od matki i tworzy jednojądrowy konidium.

Czubek sterygma ponownie pęcznieje i po tej samej procedurze tworzy się drugie konidium, które wypycha pierwsze w kierunku zewnętrznej strony. Proces ten powtarza się kilka razy iw ten sposób tworzy się łańcuch konidiów.

Konidia (ryc. 4.44C) mają strukturę owalną, eliptyczną lub kulistą, mają gładką, szorstką, echinulowaną powierzchnię zewnętrzną i różne kolory, takie jak zielony, żółty, niebieski itp.

Po dojrzewaniu konidia odrywają się od matki i są rozpraszane przez wiatr. Na odpowiednim podłożu kiełkują (ryc. 4.44D) poprzez rozwijanie bulwy zarodkowej. Jądro ulega wielokrotnemu podziałowi mitotycznemu i wszystkie jądra wchodzą do zarodka. Tworzenie przegród jest kontynuowane wraz z wydłużaniem się bulwy zarodkowej iw końcu rozwija się nowa, rozgałęziona grzybnia z przegrodami.

3. Reprodukcja seksualna:

Rozmnażanie płciowe badano tylko u kilku gatunków (ryc. 4.44). Wykazuje duże zróżnicowanie od izogamii (P. bacillosporum), oogamii (P. vermiculatum) do somatogamii (P. brefeldianum). Większość gatunków jest homotaliczna, z wyjątkiem kilku, takich jak P. luteum, heterotalicznych. Askokarpy są rzadko formowane. Na podstawie askokarpów różne rodzaje można zaliczyć do Europenicillium, Talaromyces i Carpenteles.

Rodzaj Talaromyces składa się z 15 gatunków. Wszystkie badane gatunki Talaro­myces są homotaliczne. Opis rozmnażania płciowego dotyczy Talaromyces vermiculatus (= Penicillium vermiculatum) został opisany przez Dangearda (1907). Te prędkości wykazują oogamiczny typ rozmnażania płciowego. Żeńskie i męskie narządy płciowe to odpowiednio ascogonium i antheridium’.

Ascogonium rozwija się z dowolnej komórki włókna wegetatywnego jako wyprostowane jednojądrowe i jednokomórkowe ciało (ryc. 4.44E). Jądro następnie podlega powtarzającym się podziałom mitotycznym i wytwarza 32 lub 64 jądra (ryc. 4.44F).

Antheridium rozwija się jednocześnie z askogonium z dowolnej sąsiedniej strzępki (ryc. 4.44F). Jest to również jednojądrowa i jednokomórkowa gałąź, która oplata askogonie. Region wierzchołkowy gałęzi pylnikowej odcięty przez przegrodę tworzy krótkie, nieco napompowane jedno-, jednokomórkowe i jednojądrowe antheridium (ryc. 4.44G).

Po dojrzewaniu zarówno askogonium, jak i antheridium, wierzchołek antheridium wygina się i dotyka ściany askogonalnej. Wspólna ściana w miejscu kontaktu ulega rozpadowi, a następnie dwie cytoplazmy mieszają się.

Jądro .antheridium nie migruje (ryc. 4.44H) do askogonium (Dangeard, 1907). Później parowanie jąder w askogonie odbywa się tylko przez jądra askogonalne. Ascogonium następnie dzieli się przez ściankę działową na wiele komórek dwujądrowo-szyjanowych, układających się jednolicie (ryc. 4.44H).

Niektóre z dwujądrowych komórek askogo i szyniu wystają przez tworzenie wielokomórkowych i szylarowych, rozgałęzionych strzępek askogennych, których komórki są również dikariotyczne (ryc. 4.441). Komórki wierzchołkowe grzybni dikariotycznej puchną i działają jako komórki macierzyste worka (ryc. 4.44J).

Oba jądra komórki macierzystej worka ulegają kariogamii i tworzą jądro diploidalne (2n) (ryc. 4.44K). Jądro przechodzi następnie najpierw mejozę, a następnie mito&szyzę, w wyniku czego powstaje 8 jąder tych po nagromadzeniu cytoplazmy z 8 askospor (ryc. 4.44L).

Wraz z rozwojem askogonium i antheridium, wiele sterylnych strzępek stopniowo się z nimi zaplątuje, a ostatecznie po uformowaniu się askospor cała struktura staje się okrągłym owocnikiem, tj. cleistothecium (ryc. 4.44M). worki workowe układają się nieregularnie wewnątrz cleistothecium. Askospory mogą mieć kształt kulisty, eliptyczny lub soczewkowaty z gładką, bezjądrową, wgłębioną (ryc. 4.44N) lub rozgałęzioną zewnętrzną ścianą jak koło pasowe w widoku z boku.

Askospory są uwalniane w wyniku rozpadu worka i ściany kleistoteku. Askospora kiełkuje na odpowiednim podłożu poprzez rozwinięcie bulwy zarodkowej (ryc. 4.440) i ostatecznie w grzybnię taką jak matka.


Notacja kropkowa dla dostępu do właściwości w celu-C jest wiadomość wysyłana, podobnie jak notacja nawiasowa. To znaczy, biorąc pod uwagę to:

Ostatnie dwie linie skompilują się dokładnie tak samo. Jedyną rzeczą, która to zmienia, jest to, że właściwość ma określony atrybut pobierający i/lub ustawiający, jednak wszystko, co robi, to zmiana wysyłanej wiadomości, a nie tego, czy wiadomość jest wysyłana:

Obie ostatnie linijki skompilują się identycznie.

Sprawdź artykuł z Cocoa is My Girlfriend. Istotą tego jest to, że nie ma spadku wydajności przy używaniu jednego nad drugim.

Jednak notacja utrudnia zobaczenie, co dzieje się z twoimi zmiennymi i jakie są twoje zmienne.

Różnica w wydajności będzie widoczna tylko wtedy, gdy nie oznaczysz właściwości jako „nieatomowej”. Następnie @synthesize automatycznie doda kod synchronizacji wokół ustawień Twojej właściwości, zapewniając jej bezpieczeństwo wątków - ale wolniej ustawianie i dostęp.

W związku z tym prawdopodobnie chcesz zdefiniować właściwość taką jak:

@property (nonatomic, keep) NSString *myProp

Osobiście uważam, że notacja z kropkami jest ogólnie użyteczna z punktu widzenia, że ​​nie musisz myśleć o pisaniu poprawnych metod ustawiających, co nie jest całkowicie trywialne nawet dla nieatomowych ustawiaczy, ponieważ musisz również pamiętać o prawidłowym wydaniu starej wartości. Używanie kodu szablonu pomaga, ale zawsze możesz popełnić błędy i generalnie jest to powtarzalny kod, który zaśmieca klasy.

Wzorzec, o którym należy pamiętać: jeśli sam zdefiniujesz setter (zamiast pozwalać @synthesize na jego utworzenie) i zaczniesz mieć inne skutki uboczne ustawiania wartości, prawdopodobnie powinieneś uczynić setter normalną metodą zamiast wywoływania przy użyciu notacji właściwości.

Semantyczne użycie właściwości wydaje się być bezpośrednim dostępem do rzeczywistej wartości dla wywołującego, a wszystko, co różni się od tego, powinno być wykonane poprzez wysłanie wiadomości, a nie dostęp do właściwości (nawet jeśli obaj wysyłają wiadomości).


3. Stare żeliwne zacieki

W XIX i XX wieku niektóre destylarnie szukały alternatyw. Chcieli używać materiałów, które są łatwiejsze do czyszczenia i zapewniają dłuższą żywotność. Odpowiedzią na te stulecia było żeliwo, a w kilku destylarniach wciąż można zobaczyć niektóre z tych ciężkich washbacków.

Żeliwne umywalki w Alt a Bhaine


Patenty

Informacje ogólne i kryteria wyszukiwania

Patent to dokument prawny opisujący informacje techniczne. Przegląd ten opiera się na „rodzinach patentów”, które łączą specyfikacje opisujące ten sam podstawowy wynalazek. W przeciwieństwie do innych recenzji na ten temat (Gélinas 2009 2010a 2010b), te powiązane patenty są prezentowane według najwcześniejszej daty zgłoszenia, a nie daty publikacji. Pomogło to określić priorytet powiązanych wynalazków, prześledzić wstecz pierwotnych wynalazców i lepiej oceniać trendy technologiczne i zachęty wynalazców w zależności od czasu. Podczas przygotowywania tego przeglądu stwierdzono, że w krajach takich jak Niemcy i Austria występowały duże opóźnienia między datami zgłoszenia a datami publikacji, czasami przekraczające 5 lat, zwłaszcza w okresie I i II wojny światowej około 1914-1918 i 1939-1945.

W kilku urzędach patentowych pierwszeństwo wynalazków ujawnionych w specyfikacjach złożonych po 1900 r. było na ogół sprawdzane przed przyjęciem i publikacją patentów. Jednak w Wielkiej Brytanii (GB) specyfikacje nieakceptowanych patentów były publikowane do 1883 r., ale znaleziono pełną specyfikację jednego nieakceptowanego patentu GB wydanego w 1924 r. (GB 192085). Patenty GB z datą zgłoszenia wcześniejszą niż 1916 były identyfikowane zarówno na podstawie roku zgłoszenia (a nie roku publikacji), jak i późniejszego numeru seryjnego, wprowadzono nową i ciągle numerowaną sekwencję (Rimmer i Van Dulken 1992).

W niniejszym przeglądzie nie próbowano przedstawić pełnego opisu technologii drożdży, ponieważ patenty stanowią jedynie ułamek wszystkich wynalazków. Zostało to omówione w innym miejscu (Reed i Nagodawithana 1991 Gélinas 2006). Patenty były raczej postrzegane jako uprzywilejowany i aktualny dowód ewolucji zainteresowań i obaw w branży produkcji drożdży, zwłaszcza w latach 1900-2009. Praca ta uzupełnia również przegląd patentów opublikowanych przed 1900 r. (Gélinas 2010a). Większość patentów uzyskano poprzez wyszukiwanie w bazach danych, takich jak [email protected] i Depatis. Niektóre francuskie patenty zostały zamówione przez INPI (Institut Natl. de la Propriété Intellectuelle, Paryż). Więcej szczegółów na temat metodologii podano w Gélinas (2010a). Pod koniec tego przeglądu możliwe było uzyskanie dostępu do książki opublikowanej przez Wagnera (1936), która zawiera krótkie streszczenie wielu patentów wydanych przed 1936 r. na drożdże piekarskie.


Ekspresja białka

Ekspresja rekombinowanych białek, zwłaszcza przy użyciu wektorów i gospodarzy bakteryjnych, jest dojrzałą technologią. Dzięki odpowiednim metodom cDNA i PCR można szybko wytworzyć plazmidy ekspresyjne. Po określeniu sekwencji konstruktów plazmidy są transformowane do gospodarzy ekspresyjnych, zbierane są pojedyncze kolonie i przeprowadzana jest fermentacja. Z E coli, wygeneruje 2-litrowa fermentacja przy użyciu złożonej pożywki

50 do 80 g (mokra masa komórek). Zakładając niewielką ekspresję białka (2% do 5% całkowitego białka komórkowego), w komórkach dostępnych jest od 100 do 300 mg białka rekombinowanego. Problem polega oczywiście na tym, jak wyizolować go w aktywnej formie. Białka rozpuszczalne można odzyskiwać z dobrą wydajnością (㹐%), a białka nierozpuszczalne, które muszą przejść cykl denaturacji i fałdowania, można odzyskiwać ze skromniejszą wydajnością (5% do 20%). W związku z tym, stosując fermentacje na małą skalę i sprzęt do przetwarzania na skalę laboratoryjną, białka (lub ich poddomeny) można zwykle wytwarzać w ilościach wystarczających (10 do 100 mg), aby rozpocząć większość badań, w tym szczegółowe oznaczenia strukturalne. Niektóre strategie osiągania wysokiego poziomu ekspresji genów w E coli zostały przejrzane przez Markridesa (1996) i Baneyxa (1999) i są również omówione w rozdziale 5.24.

Niektóre z powyższych cech są również prawdziwe w przypadku wytwarzania białek przy użyciu eukariotycznych systemów ekspresyjnych drożdży i bakulowirusa, chociaż do skonstruowania wektorów i wytworzenia komórek do obróbki potrzeba więcej wysiłku i wiedzy specjalistycznej. System ekspresji drożdży może być dobrym wyborem dla białek, które tworzą nierozpuszczalne wtrącenia w bakteriach oraz do produkcji białek związanych z błoną (Cereghino i Clegg, 1999 UNITS 5.6𠄵.8). System bakulowirusa okazał się bardzo przydatny do wytwarzania fosforylowanych białek i glikoprotein (Kost, 1999 UNITS 5.4𠄵.5) oraz do koekspresji białek wchodzących w interakcje. Konstrukcja stabilnych wektorów ekspresyjnych białek ssaków wymaga znacznie więcej czasu i wysiłku, ale może być jedynym podejściem do wytwarzania złożonych wielodomenowych białek (UNITS 5.9𠄵.10). Oczekuje się, że komórki rosnące do gęstości komórek 1𠄵휐 9 komórek/ml zwykle wydzielają㸐 mg/litr produktu. Alternatywnie, do wytwarzania mniejszych ilości białka można zastosować systemy przejściowej ekspresji genów wykorzystujące różne wektory wirusowe (np. wirus krowianki UNITS 5.12𠄵.15), co jest przydatne w badaniach wykonalności. Warto zauważyć, że systemy przejściowej ekspresji na dużą skalę w komórkach ssaków są aktywnie rozwijane przez firmy biotechnologiczne (Wurm i Bernard, 1999).

Wybór systemu gospodarza do produkcji białek rekombinowanych jest omówiony w rozdziale 5.16, a także zwięźle podsumowany przez Brondyke (2009). W czasopiśmie ukazało się również specjalne wydanie dotyczące produkcji białek rekombinowanych Postępy biotechnologiczne (Sanchez i Demin, 2012). W tym wydaniu znajdują się doskonałe przeglądy ekspresji i produkcji białek przy użyciu E coli (Chen, 2012) drożdże (Celik i Calik, 2012) komórki owadów i system bakulowirusa (Drugmand i in. 2012) komórki ssaków (Zhu, 2012) systemy bezkomórkowe (Carlson i in., 2012) oraz komórki roślinne (Xu i in. ., 2012).

Jak wspomniał Chen (2012), dla wielu badaczy początkowy wybór to często: Escherichia coli który pozostaje preferowanym systemem do badań laboratoryjnych i początkowego rozwoju działalności komercyjnej i stanowi punkt odniesienia dla porównania między innymi różnymi platformami ekspresyjnymi. Wynika to z takich czynników, jak łatwość manipulacji genetycznych, dostępność zoptymalizowanych plazmidów ekspresyjnych i łatwość wzrostu. Ta jednostka przedstawia przegląd procesu oczyszczania rekombinowanych białek ze szczególnym uwzględnieniem białek wyrażanych w E coli. Praktyczne aspekty i strategie są podkreślane w całym tekście, a tam, gdzie to możliwe, dyskusja jest powiązana z przykładowymi protokołami opisanymi w dalszej części Rozdziału 6.

Pierwsza część dotyczy informacji dotyczących oczyszczania białka, które można uzyskać z translacji sekwencji cDNA. Po tym następuje krótkie omówienie niektórych typowych problemów związanych z ekspresją białek bakteryjnych (patrz również UNIT 5.1). Planowanie strategii oczyszczania białka wymaga określenia rozpuszczalności produktu ekspresji, przydatne jest również ustalenie lokalizacji białka w komórce, np. cytoplazmie lub peryplazmie. Ta jednostka zawiera schematy blokowe, które podsumowują podejścia do ustalania rozpuszczalności i lokalizacji białek wytwarzanych przez bakterie (patrz również JEDNOSTKA 5.2).

Strategie oczyszczania zarówno rozpuszczalnych, jak i nierozpuszczalnych białek są przejrzane i podsumowane na schematach blokowych (patrz także Rozdział 1). Wiele poszczególnych etapów oczyszczania, zwłaszcza tych obejmujących chromatografię, zostało szczegółowo omówionych w rozdziałach 8 i 9 oraz w innych miejscach (Scopes, 1994 Janson, 2011). Opisane tutaj metodologie i podejścia są zasadniczo odpowiednie dla operacji na skalę laboratoryjną. Metodologie na dużą skalę zostały wcześniej przejrzane (Asenjo i Patrick 1990 Thatcher, 1996 Sofer i Hagel, 1997).

Zawarto rozdział dotyczący glikoprotein wytwarzanych w bakteriach w stanie nieglikozylowanym, aby podkreślić, że chociaż mogą one nie być przydatne w badaniach in vivo, takie białka dobrze nadają się do badań strukturalnych. Ostatnie sekcje dotyczą postępowania z białkami, skali i celów oczyszczania oraz specjalistycznego sprzętu potrzebnego do oczyszczania i charakteryzowania rekombinowanych białek.


Jak działa metoda naukowa

Oczywiście metoda naukowa jest potężnym narzędziem, ale ma swoje ograniczenia. Ograniczenia te wynikają z faktu, że hipoteza musi być testowalna i falsyfikowalna, a eksperymenty i obserwacje muszą być powtarzalne. Stawia to pewne tematy poza zasięgiem metody naukowej. Nauka nie może udowodnić ani obalić istnienia Boga ani jakiejkolwiek innej istoty nadprzyrodzonej. Czasami stosuje się zasady naukowe, aby nadać wiarygodność pewnym nienaukowym pomysłom, takim jak: inteligentny design. Inteligentny projekt to twierdzenie, że pewne aspekty powstania wszechświata i życia można wyjaśnić tylko w kontekście inteligentnej, boskiej mocy. Zwolennicy inteligentnego projektu próbują przekazać tę koncepcję jako teorię naukową, aby uczynić ją łatwiejszą do przyjęcia dla twórców programów nauczania szkół publicznych. Ale inteligentny projekt nie jest nauką, ponieważ istnienia boskiej istoty nie można sprawdzić za pomocą eksperymentu.

Nauka nie jest również zdolna do wydawania sądów wartościujących. Nie można na przykład powiedzieć, że globalne ocieplenie jest złe. Może badać przyczyny i skutki globalnego ocieplenia i raportować te wyniki, ale nie może twierdzić, że prowadzenie SUV-ów jest złe lub że ludzie, którzy nie wymienili swoich zwykłych żarówek na kompaktowe świetlówki, są nieodpowiedzialni. Czasami niektóre organizacje wykorzystują dane naukowe do rozwijania swoich przyczyn. Zaciera to granicę między nauką a moralnością i zachęca do tworzenia „pseudo-nauki”, która próbuje legitymizować produkt lub pomysł za pomocą twierdzenia, które nie zostało poddane rygorystycznym testom.

A jednak, właściwie stosowana, metoda naukowa jest jednym z najcenniejszych narzędzi, jakie ludzie kiedykolwiek stworzyli. Pomaga nam rozwiązywać codzienne problemy związane z domem, a jednocześnie pomaga nam zrozumieć głębokie pytania dotyczące świata i wszechświata, w którym żyjemy.

W większości przypadków dwie konkurujące teorie nie mogą istnieć, aby opisać jedno zjawisko. Ale w przypadku światła jedna teoria nie wystarczy. Wiele eksperymentów potwierdza pogląd, że światło zachowuje się jak fala podłużna. Podsumowując, eksperymenty te dały początek falowej teorii światła. Jednak inne eksperymenty potwierdzają pogląd, że światło zachowuje się jak cząsteczka. Zamiast odrzucać jedną teorię i zatrzymywać drugą, fizycy utrzymują dualizm falowo-cząsteczkowy, aby opisać zachowanie światła.


Klasyfikacja mikroorganizmów | Mikrobiologia

Poniższe punkty podkreślają trzy główne systemy klasyfikacji mikroorganizmów. System klasyfikacji to: 1. System Klasyfikacji Pięciu Królestw 2. System Klasyfikacji Ośmiu Królestw 3. System Klasyfikacji Trzech Dziedzin.

1. System Klasyfikacji Pięciu Królestw:

Później rozróżniono organizmy prokariotyczne i eukariotyczne na podstawie anatomii komórki, a pojęcie bakterii jako organizmu prokariotycznego zostało ustalone w mikrobiologii w 1962 roku przez Stamira i Van Niela. W 1969 Whittaker zaproponował system pięciu królestw składający się z królestwa plantae, grzybów, animalia, protista i monera (ryc. 2.3) dla wszystkich organizmów na podstawie ich systemów wytwarzania energii i anatomii komórki.

Mikroorganizmy o wspólnych cechach opisanych powyżej występują w królestwach monery, protista, grzybów i części roślin. Ostatnio na podstawie sekwencji rybosomalnego RNA i innych danych zdefiniowano związki ewolucyjne organizmów żywych.

Królestwo Monera prokariotae obejmuje wszystkie mikroorganizmy prokariotyczne. Protista składa się z jednokomórkowych lub wielokomórkowych organizmów eukariotycznych, ale brakuje prawdziwych tkanek. Królestwo Grzybów zawiera organizmy eukariotyczne i wielojądrowe.

Członkowie mają chłonny sposób żywienia. Animalia zawiera zwierzęta wielokomórkowe pozbawione ściany komórkowej. Spożycie jest sposobem odżywiania. Królestwo Plantae obejmuje wielokomórkowe eukarionty. Ich sposobem odżywiania jest fotosynteza.

2. System klasyfikacji i szyfikowania ośmiu królestw:

Cavalier-Smith (1987, 1993) sklasyfikował protistów na osiem królestw na podstawie ultrastruktury komórek i organizacji genetycznych (sekwencjonowanie rRNA i inne dane). Podzielił wszystkie organizmy na dwa imperia (Bakterie i Eukariota) (ryc. 2.4). Imperium Bakterie obejmuje dwa królestwa (Eubacteria i Archaeobacteria). Imperium Eukariota obejmuje sześć królestw (Archezoa, Protozoa, Plantae, Chromista, Fungi i Animalia).

Królestwo Chromista obejmuje okrzemki, algi brunatne, krypto-monady i lęgniowce. Członkowie Chromista są fotosyntetyczni i mają swój chromoplast w świetle retikulum endoplazmatycznego, ale nie w cytoplazmie.

3. Trzydomenowy system klasyfikacji:

Woese (1990) zauważył, że bakterie są oddalone od roślin i zwierząt, a rośliny i zwierzęta nie są tak daleko od siebie. Dlatego ustanowili nową, nadrzędną koncepcję domen nad królestwem i zaproponowali trzy domeny, Bakterie, Archaea i Eukarya w 1991 roku (ryc. 2.5).

Ryc. 2.5: Uniwersalne drzewo filogenetyczne pochodzące z porównawczego sekwencjonowania rybosomalnego RNA 16S lub 18S.

Domeny Archaea i Eukarya są ze sobą wyraźnie powiązane. Eukarya obejmuje organizmy, które posiadają acylodiestry tłuszczowe glicerolu jako lipidy błonowe i eukariotyczne rRNA. Domena Bakterie składa się z takich członków, które zawierają lipidy błonowe, takie jak diestry diacyloglicerolu i rRNA eubakterii.

Cząsteczka domeny Archaea składa się z izoprenoidowych lipidów diestru glicerolu (lub tetraeteru diglicerolu) w ich błonie i archebakterii rRNA.

W nowoczesnym sensie bakterie, cyjanobakterie, promieniowce itp. są rozproszone w domenie bakterie metanogeny organizmy skrajnie termofilne, organizmy skrajnie halofilne itp. są w domenie Archaea i pleśnie, drożdże, podstawczaki, glony i pierwotniaki itp. domena Eukaria. Mikroorganizmy są uważane za kolekcje ewolucyjnie różnych organizmów.


Przenieś go w bezpieczne miejsce

Gdy butelka całkowicie się napełniła, przenieśliśmy cały eksperyment z cukrem drożdżowym do zlewu. Bąbelki poruszały się powoli i nie było się czym martwić, ale N lubił ściągać balon i patrzeć, jak piana powoli przelewa się na górę butelki.


Materiały i metody

Procedura dopasowania maksymalnego prawdopodobieństwa (Rysunek 2D) została zaimplementowana w MATLAB, a kod źródłowy jest dostępny pod adresem https://github.com/gerland-group/PHO5_on-off-slide_models.

Pasuje maksymalne prawdopodobieństwo

W zależności od etapu analizy zoptymalizowaliśmy wartości parametrów, czyli wartości szybkości procesów w ramach danego modelu r → , maksymalizując sumę log10 wartości prawdopodobieństwa: LI ⁢ ( r → ) w etapie 1, LI ⁢ ( r → ) + LI ⁢ I ⁢ ( r → ) w etapie 2 i LI ⁢ ( r → ) + LI ⁢ I ⁢ ( r → ) + LI ⁢ I ⁢ I ⁢ ( r → ) w etapie 3. Uwaga że optymalne r → może różnić się między różnymi etapami. Zignorowaliśmy stałe addytywne do logarytmu prawdopodobieństwa, tak aby po włączeniu kolejnego zbioru danych do dopasowania idealna zgodność między modelem a dodatkowym zbiorem danych, już przy wartościach r → z poprzedniego etapu, prowadziła do tego samego logarytmu prawdopodobieństwa wartość jak poprzednio. We wszystkich etapach użyliśmy funkcji MATLAB fmincon, aby znaleźć wartości parametrów r →, które maksymalizują prawdopodobieństwo.

Z notacją parametru szybkości wprowadzoną na rysunku 2 mamy dla przykładu z rysunku 3A:

Niech Q ⁢ ( r → σ ) będzie macierzą szybkości przejścia procesu Markowa określoną przez model stanu promotora σ , gdzie r → σ oznacza wektor zawierający regulowaną wartość (wartości) parametru stanu promotora σ i wszystkie konstytutywne wartości parametrów . Niediagonalny wpis Q i ⁢ j ⁢ ( r → σ ) jest szybkością przechodzenia od konfiguracji i do konfiguracji j i jest niezerowy tylko dla prawidłowych reakcji montażu, demontażu i poślizgu, a następnie podany przez wpis r → σ który przechowuje wartość parametru procesu rządzącego tą reakcją w danym modelu. Jeśli reakcje ślizgowe nie są regulowane przez żaden proces ślizgowy w modelu, ich szybkość jest ustawiona na zero. Wpisy po przekątnej są podane przez Q i ⁢ i ⁢ ( r → σ ) = - ∑ j ≠ i Q i ⁢ j ⁢ ( r → σ ) . W przykładzie z rysunku 3A macierz szybkości przejścia w stanie aktywowanym jest dana wzorem (przy czym „ … ” oznacza wpisy diagonalne)

Rozkład stanu ustalonego p i ⁢ σ Q ⁢ ( r → σ ) jest rozwiązaniem p j ⁢ σ = ∑ i p i ⁢ σ ⁢ Q i ⁢ j ⁢ ( r → σ ) = 0 .

Wtedy L I ⁢ ( r → ) można obliczyć korzystając z rozkładu wielomianowego,

gdzie n i ⁢ σ jest liczbą obserwacji odpowiednich konfiguracji promotorów (Rysunek 1 — dane źródłowe 1).

Dla każdego modelu użyliśmy 100 różnych zestawów początkowych wartości parametrów, aby zapewnić solidne maksimum. Do obliczenia rozkładu stanu ustalonego danego modelu dla stałych wartości parametrów posłużono się algorytmem redukcji stanu (Sheskin, 1985 Grassmann i in., 1985 Shanbhag i Rao, 2003). Alternatywnie, twierdzenie Matrix-Tree może być użyte do znalezienia stacjonarnych rozkładów procesów Markowa (Wong i Gunawardena, 2020). Ograniczyliśmy zakres wartości parametrów do [10 - 2 10 2 ] , gdzie jeden jest wartością współczynnika globalnego procesu asemblacji dla stanu aktywowanego. Szerszy zakres [10 - 3 10 3 ] nie miał wpływu na wyniki. W 3,6% wszystkich modeli 100 prób znalazło co najmniej dwie różne maksymalne wartości prawdopodobieństwa, które zawsze były skrajnie niskie. W 2,4% wszystkich modeli znalezione wartości parametrów maksymalnego prawdopodobieństwa nie były unikatowe. W obu przypadkach żaden z tych problematycznych modeli nie znalazł się wśród modeli o stosunkowo wysokim maksymalnym prawdopodobieństwie prawdopodobieństwa.

W etapie 2 optymalizowana jest suma L I ⁢ ( r → ) i L I ⁢ I ⁢ ( r → ). Zakładając, że eksperymentalne zmiany krotności mają rozkład normalny, log10 prawdopodobieństwa odtworzenia przez model nowych danych aż do stałej addytywnej jest dana wzorem

gdzie fs ⁢ m średnia i fs ⁢ m var są odpowiednio średnią i wariancją zmierzonej dostępności krotność zmian stanu aktywnego lepkiego mutanta N-3 m w miejscu nukleosomu s (dwa dla N-2 i 3 dla N-3) , fs ⁢ ( r → , κ → m ) jest odpowiednią zmianą krotności modelu, a κ → m jest wartościami prefaktorów szybkości lepkiego mutanta m .

Aby uzyskać fs ⁢ ( r → , κ → m ) dla każdego modelu, obliczyliśmy zmodyfikowaną macierz szybkości przejścia dla każdego mutanta przy użyciu niediagonalnej części macierzy szybkości przejścia Q ⁢ ( r → akt ) i pomnożyliśmy ją na części składowe z macierzą W ⁢ ( κ → m ) zawierającą wartości prefaktorów κ → m dla dotkniętych reakcji dla mutanta m (i jednej w przeciwnym razie). Korzystając ze zmodyfikowanych macierzy szybkości przejścia, obliczyliśmy rozkłady mutantów w stanie stacjonarnym i ostatecznie odpowiadające im krotności współczynników dostępności przy N-2 i N-3.

Użyliśmy czterech prefaktorów na lepkiego mutanta N-3, po jednym dla każdej grupy reakcji, montaż w N-3, deasemblacja w N-3, przesuwanie się z N-3 do N-2 i z N-2 do N-3 (Rysunek 2—uzupełnienie cyfry 5), prowadzące odpowiednio do κ → m = ( a ⁢ 3 m , κ d ⁢ 3 m , κ s ⁢ 23 m , κ s ⁢ 32 m ) ⊤ . Niediagonalna część W ⁢ ( κ → m ) jest wtedy dana przez

gdzie przekątna nie ma znaczenia ze względu na mnożenie składowych z niediagonalną częścią Q ⁢ ( r → akt ) w celu uzyskania niediagonalnej części macierzy zmian tempa mutacji. Zatem L I ⁢ I zależy tylko od r → akt . Należy zauważyć, że dokładne wartości prefaktorów znalezione podczas optymalizacji zależały od ich warunków początkowych, ponieważ ich najlepsze wartości były często niechlujne lub nie unikatowe, ale nadal skutkowały maksymalnym prawdopodobieństwem.

Dla etapu 3 L I ⁢ I ⁢ I ma dwa wkłady, po jednym dla każdego eksperymentu wymiany histonów H3:

Ściśle mówiąc L I ⁢ I ⁢ I zależy tylko od r → rep , ponieważ wszystkie eksperymenty z wymianą histonów H3 zostały wykonane w stanie stłumionym. Dla pierwszego wkładu, aby dopasować dane z Rufiange et al., 2007, użyliśmy

gdzie g średnia i g var są odpowiednio średnią i wariancją zmierzonych współczynników log2 ilości Flag przy N-1 do N-2 (Flag-H3 MNaza-ChIP w Rufiange i in., 2007, wartości współczynnika 0,591 i 0,483 dla powtórzeń 1 i 2, odpowiednio) i g ⁢ ( r → , t ′ ) odpowiedni stosunek log2 modelu (patrz rozdział Materiały i metody: model wymiany histonów H3) dla czasu pomiaru t ′ = 2 h (nieskorygowany dla czas opóźnienia).

Dla drugiego wkładu, niech hj oznacza zmierzone, znormalizowane średnie proporcje log2 ilości Flag do ilości Myc w N-1, przy czym j = 1, 2, 3, 4 wskazuje cztery różne punkty czasowe. Otrzymaliśmy h → średnia = ( - 0,417 , 1,24 , 1,87 , 2,60 ) ⊤ z Dion et al., 2007 w następujący sposób: ponownie obliczyliśmy stałą normalizacji dla każdego punktu materiału Dion et al., 2007 przy użyciu danych z komercyjnych mikromacierzy całego genomu (Agilent) z parametrami puli nukleosomów jak w sekcji powyżej), a następnie wziął znormalizowane wyniki sondy w pozycji N-1 PHO5 promotor (chr2:431049–431108). Niestety, sąsiednie sondy znajdowały się tylko w regionach łącznikowych między pozycjami promotora w nukleosomie. Jak wspomniano w Dion et al., 2007 i potwierdzono własnymi obliczeniami, wartości średnie h j są obarczone dużymi niepewnościami, głównie ze względu na addytywną rozchwianą globalną stałą normalizacyjną prowadzącą do błędów systematycznych, podczas gdy różnice między punktami czasowymi zostały określone z rozsądną dokładnością. Dlatego zdecydowaliśmy się dopasować zmierzone wartości dopiero po transformacji, która eliminuje niechlujną globalną stałą normalizacyjną, wybierając średnią z czterech punktów czasowych jako odniesienie: h

j średnia = h j średnia - 1 / 4 ⁢ ∑ k = 1 4 h k średnia . Let C be the resulting covariance matrix after this linear transformation, assuming an independent estimated experimental standard deviation of 0.4 before the transformation. This estimate was informed by the standard deviation of the Rufiange et al., 2007 data as well as from perturbations of the nucleosome pool parameters when recalculating the normalization constants. The corresponding normalized values of the model are denoted by h

j ⁢ ( r → ) , calculated from the log2 ratios of Flag amount over Myc amount at N-1, h ⁢ ( r → , t j ) (see Materials and methods section: H3 histone exchange model), using the same transformation, with t j denoting the measurement time points. Since the four measurements at different time points were linearly mapped to always have an average of zero, the estimated density follows a degenerate multivariate normal distribution with the covariance matrix C . Thus the log10 likelihood can be calculated with

where C + is the Moore-Penrose inverse (pseudoinverse) of C .

H3 histone exchange model

To obtain the Flag and Myc amounts in a given model with given parameter values and then determine g ⁢ ( r → , t ′ ) and h ⁢ ( r → , t j ) , we used the histone pool and nucleosome turnover models in Dion et al., 2007 and assumed that the Myc H3 and Flag H3 amounts in the histone pool are given by M ( t ) = α M β M and

where we used the production rates α F = 50 / min , α M = 10 / min , the degradation rates β F = 0.01 / min , β M = 0.03 / min and the lag time t 0 = 15 min which were fitted in Dion et al., 2007. For t > t 0 , the probability that a newly assembled nucleosome contains a Flag H3 is given by

In Dion et al., 2007, the conditional probability that a given nucleosome at site ja o czasie T contains a Flag H3 then fulfills the ordinary differential equation

with λ l being an effective turnover rate at probe position l . In our case, the dynamics of the three promoter nucleosomes are coupled, determined by the transition rate matrix Q ⁢ ( r → σ ) of a given regulated on-off-slide model. At this stage, we included different nucleosome types (i.e. Flag and Myc) into the model, replacing the eight promoter configurations by all 27 possibilities to arrange no, a Flag or a Myc nucleosome at each of the three sites. Based on Q ⁢ ( r → σ ) and P + ⁢ ( t | N ) , we define an extended Flag/Myc transition rate matrix E ⁢ ( r → σ , P + ⁢ ( t | N ) ) . Each ‘new’ assembly reaction rate in E ⁢ ( r → σ , P + ⁢ ( t | N ) ) is given by the corresponding ‘old’ assembly rate in Q ⁢ ( r → σ ) times either P + ⁢ ( t | N ) or 1 - P + ⁢ ( t | N ) , for a new Flag or Myc nucleosome, respectively. To find the corresponding ‘old’ reaction any extended Flag/Myc configuration is projected to one of the eight normal nucleosome configurations simply by ignoring the Flag/Myc tag information. For example, denoting Flag- and Myc-tagged nucleosomes with ‘F’ and ‘M’, respectively, an assembly reaction from the state (F, M, 0) to the state (F, M, M) in the extended model corresponds to an assembly reaction from state (1, 1, 0) to the state (1, 1, 1) in the normal model, and its reaction rate is multiplied by 1 - P + ⁢ ( t | N ) in the extended model, since the new nucleosome is Myc-tagged. The rates of sliding and disassembly of Flag or Myc nucleosomes are assumed to be equal to the corresponding normal sliding and disassembly rates. The probability of extended configuration i at time t is the i -th entry of q → * ⁢ ( t ) , the solution of

where σ is fixed in the repressed state, in which all histone exchange experiments took place. The log2 ratios of Flag at N-1 over Flag at N-2 amount, g ⁢ ( r → , t ) , and Flag over Myc amounts at N-1, h ⁢ ( r → , t ) , of each model then correspond to log2 ratios of sums of q i * ⁢ ( t ) over suitable configurations i with Flag or Myc nucleosomes at the wanted sites.

Sensitivity analysis

In order to determine how sloppy the found best parameter values for a given model are, we performed a simple sensitivity analysis, by calculating the log10 likelihood L I + L I ⁢ I + L I ⁢ I ⁢ I along certain directions from the best fit point in logarithmic parameter space. We found that an approximation of the real likelihood function by a second-order Taylor expansion at the best fit point worked only in a small area, as expected in a highly non-linear setting, but too small to determine parameter sloppiness properly.

As a compromise between properly scanning the parameter space and computational feasibility, we chose a small number of test directions: each fitted parameter value individually, the eigenvectors of the numerical Hessian of the likelihood function at the best fit, as well as the numerical gradient, which can be non-zero if the best fit point lies on the boundary. We ignored the boundary during the sensitivity analysis, to also take into account sloppiness that 'reaches over’ the boundary. Along these directions, we tested in exponentially increasing steps from the best fit position which positions in parameter space lead to a decrease of the likelihood by ≈ 50 % , that is, a log10 likelihood ratio change of ≈ 0.30 , which is of similar order as the log10 likelihood differences within our group of satisfactory models. We then obtained 'error bars’ for each parameter by taking the largest deviation of the log10 parameter value at the 50% likelihood level from the best value found in all tested directions (Figure 4—source data 1 and Figure 4—source data 2).

Effective chromatin opening and closing rates

The effective trajectory in time of the regulated process rate from the value of the repressed state to the value of the activated state depends on how fast the cell senses the phosphate starvation and subsequent signal processes. To obtain a reasonable upper bound for the chromatin opening rate, we assumed the regulation happens instantaneously, that is, the activated rate value of the regulated processes applies immediately at the change of the medium for a population in repressed state. Then the promoter configuration distribution decays exponentially toward the activated steady state with a rate well approximated by the negative eigenvalue of the transition rate matrix closest (but not equal) to zero, taking into account the fitted time scale. This ‘effective chromatin opening rate’ is an upper bound of how fast a given model can switch to the activated state. Conversely, we did the same calculations for the ‘effective chromatin closing rate’, which is an upper bound of how fast a given model can switch to the repressed state.

Sticky N-3 experiments

Strains 'sticky N-3 mutant 1’ and 'sticky N-3 mutant 2’ used for restriction enzyme accessibility assays were generated by transformation of linear fragments of plasmids ECS53 and ECS56, respectively, into the wild type strain BY4741 as described for the 'periodicity mutants’ in Small et al., 2014. For the sticky N-3 mutant 1, the sequence GTTTTCTCATGTAAGCGGACGTCGTC inside the PHO5 promoter was replaced with GTTTTCTTATGTAAGCTTACGTCGTC . For sticky N-3 mutant 2, GCGCAAATATGTCAACGTATTTGGAAG was replaced with GCGCAAATATGTCAAAGTATTTGGAAG . Strains were grown in YPDA medium to logarithmic phase for repressive (+Pi) and shifted from logarithmic phase to phosphate-free YNB medium (Formedia) over night for inducing (-Pi) conditions. Nuclei preparation, restriction enzyme digestion, DNA purification, secondary digest, agarose gel electrophoresis, Southern blotting, hybridization, and Phosphorimager analysis were as in Musladin et al., 2014. Secondary digest was with HaeIII for both ClaI and HhaI digests probing N-2 or N-3, respectively. The probe for both ClaI and HhaI digests corresponded to the ApaI-BamHI restriction fragment upstream of N-3.


Obejrzyj wideo: Oddychanie drożdży (Styczeń 2023).