Informacja

Jak zsekwencjonowano miejsce restrykcyjne EcoRI?

Jak zsekwencjonowano miejsce restrykcyjne EcoRI?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Sekwencja miejsca restrykcyjnego EcoRI - GAATTC została zidentyfikowana na początku lat 70., zanim wynaleziono sekwencjonowanie Sangera. (1977)

Jak zsekwencjonowano miejsce restrykcyjne EcoRI?


Pierwsze określenie miejsca rozpoznawania endonuleazy restrykcyjnej opisano w:

Kelly & Smith (1970) Enzym restrykcyjny z Hemophilus influenzae II. Sekwencja zasad miejsca rozpoznania. J Mol. Biol. 51: 393-409

Enzym nazywano wówczas endonukleazą R, ale obecnie znany jest jako HindII (lub HincII).

Zastosowana metoda polegała na cięciu DNA enzymem, a następnie usunięciu odsłoniętych końcowych fosforanów za pomocą fosfatazy alkalicznej. Te końce można następnie oznaczyć 32P przy użyciu kinazy polinukleotydowej i ATP znakowanego γ.

DNA znakowany na końcach poddano następnie działaniu nukleaz na trzy różne sposoby, aby uwolnić mononukleotydy, dinukleotydy i mieszaninę wzbogaconą o trinukleotydy. W każdym przypadku znakowane produkty identyfikowano na podstawie ich zachowania w chromatografii cienkowarstwowej 2D i dalej charakteryzowano ich całkowity skład zasad po trawieniu do mononukleotydów, jeśli było to właściwe.

Wydedukowana strona była/jest

5'----GTY RAC----3' 3'----SAMOCHÓD YTG----5'

Zatem stwierdzono, że znakowane mononukleotydy to A i G (puryna=R), dinukleotydy to GA i AA i tak dalej.

Sekwencja EcoRI została określona zasadniczo tą samą metodologią i została zgłoszona przez

Hedgpeth i wsp. (1972) sekwencja nukleotydowa DNA ograniczona przez endonukleazę RI. Proc. Natl. Acad. Sci USA 69:3448 - 3452

Uzupełnienie:

Chociaż sekwencjonowanie Sangera (metoda plus-minus) mogło być rozwijane w latach 70-tych, tak naprawdę nie przyjęło się aż do wczesnych lat 80-tych. Tak więc na przykład pierwszą pełną sekwencją plazmidu, którą należy określić, był pBR322 w 1979 roku:

Sutcliffe (1979) Pełna sekwencja nukleotydowa plazmidu pBR322 Escherichia coli. Symp. CSH Ilość Biol. 43: 77 - 90

„Określiłem sekwencję 4362 par nukleotydów plazmidowego wektora klonującego pBR322 przy użyciu techniki sekwencjonowania DNA Maxama i Gilberta (1977). Struktura DNA ma kilka interesujących cech, które prowadzą do możliwych do przetestowania prognoz”.

Standardową metodą sekwencjonowania stosowaną w tym czasie było sekwencjonowanie chemiczne metodą Maxama-Gilberta. Kiedy w 1979 roku rozpoczynałem staż podoktorski w USA, standardową metodą było sekwencjonowanie M-G. Sekwencjonowanie Sangera naprawdę wystartowało dopiero po opracowaniu wektorów M13 mp (a później plazmidów pUC) przez J Messinga na początku lat 80-tych. I jaka to była ulga: sekwencjonowanie M-G było niezwykle pracochłonne, jak zezna każdy, kto to zrobił.


EkoRI

EkoRI (wymawiane „eco R one”) jest enzymem restrykcyjnym endonukleazy wyizolowanym z gatunku E coli. Jest to enzym restrykcyjny, który tnie podwójne helisy DNA na fragmenty w określonych miejscach, a także jest częścią systemu modyfikacji restrykcyjnych. ten Eko część nazwy enzymu pochodzi od gatunku, z którego został wyizolowany – „E” oznacza nazwę rodzajową, którą jest „Escherichia”, a „co” oznacza nazwę gatunku „coli” – podczas gdy R oznacza konkretny szczep, w tym przypadku RY13 , a I oznacza, że ​​był to pierwszy enzym wyizolowany z tego szczepu.

W biologii molekularnej jest stosowany jako enzym restrykcyjny. EkoRI tworzy lepkie końce z 4 nukleotydów z wystającymi końcami 5' AATT. Sekwencją rozpoznawaną przez kwas nukleinowy, w której tnie enzym jest G↓AATTC, ma palindromową, komplementarną sekwencję CTTAA↓G. Inne enzymy restrykcyjne, w zależności od ich miejsc cięcia, mogą również pozostawiać nawisy 3' lub tępe końce bez nawisów.


Enzymy restrykcyjne

DNA można wyciąć przez endonukleazy restrykcyjne ( ODNOŚNIE ). Endonukleazy to enzymy, które mogą hydrolizować polimer kwasu nukleinowego poprzez rozerwanie fosfodiestr wiązanie między fosforanem i pentozą na szkielecie kwasu nukleinowego. Jest to bardzo silne wiązanie kowalencyjne, podczas gdy słabsze wiązania wodorowe zachowują swoje interakcje i dwuniciowość.

Jak sama nazwa wskazuje, endonukleazy restrykcyjne (lub enzymy restrykcyjne) to „ograniczony” w ich zdolności do cięcia lub trawienia DNA. Ograniczeniem, które jest przydatne dla biologów, jest zwykle: palindromiczny Sekwencje DNA. Sekwencje palindromiczne to ta sama sekwencja do przodu i do tyłu. Kilka przykładów palindromów: WYŚCIGOWY, OBYWATELSKI, CZŁOWIEK PLANUJE KANAŁ PANAMA. W odniesieniu do DNA istnieją 2 nici, które działają przeciwnie do siebie. Dlatego odwrotne dopełnienie jednej nici jest identyczne z drugą. Biolodzy molekularni również mają tendencję do używania tych specjalnych nożyczek molekularnych, które rozpoznają palindromy 6 lub 8. Dzięki zastosowaniu 6- lub 8-ostrzowych sekwencje występują na dużych odcinkach rzadko, ale często na tyle, aby były użyteczne.

EcoRI generuje lepkie spoiste końce SmaI generuje tępe końce

Enzymy restrykcyjne hydrolizują kowalencyjne wiązania fosfodiestrowe DNA, pozostawiając „lepkie/spójne” końce lub „tępe” końce. To rozróżnienie w cięciu jest ważne, ponieważ EcoRI lepki koniec może być użyty do dopasowania kawałka DNA pociętego tym samym enzymem w celu sklejenia lub związania ich z powrotem. Podczas gdy endonukleazy tną DNA, ligazy połącz je z powrotem. DNA trawione EcoRI można ponownie zligować z innym kawałkiem DNA trawionym EcoRI, ale nie do kawałka przetrawionego SmaI. Kolejny tępy nóż to EcoRV z sekwencją rozpoznawania GAT | ATC.


Zastosowanie endonukleaz restrykcyjnych HindIII i EcoRI w identyfikacji i diagnostyce mukowiscydozy wywołanej mutacją CFTR ∆F508

Mukowiscydoza (CF) jest spowodowana mutacją białka CFTR, która uniemożliwia transport soli przez powierzchnie komórek nabłonka, prowadząc do hiperprodukcji śluzu i ostatecznie do śmierci. Celem tego eksperymentu było ustalenie, czy 3-letni pacjent ma mukowiscydozę. Hipoteza zakładała, że ​​Jeff miałby mukowiscydozę spowodowaną mutacją CFTR ∆F508. Przewidywano, że DNA Jeffa i kontrola pozytywna/negatywna zostaną przecięte przez EcoRI dwa razy dając trzy prążki o rozmiarach 2150 pz, 2150 pz i 4700 pz, a DNA Jeffa i kontrola pozytywna zostaną przecięte przez HindIII po wytworzeniu dwóch prążki o rozmiarach 7200 pz i 1800 pz. W eksperymencie zastosowano endonukleazy restrykcyjne EcoRI i Hindlll w analizie RFLP i wizualizowano wyniki za pomocą elektroforezy w żelu agarozowym, wielkość cząsteczkową tych fragmentów DNA obliczono z równania otrzymanego z wykresu krzywej standardowej. DNA pacjenta z mutacją CFTR ∆F508 włączono jako kontrolę pozytywną, a DNA pacjenta bez mutacji CFTR ∆F508 włączono jako kontrolę negatywną. Wyniki eksperymentu wykazały, że wszystkie próbki DNA pocięte przez EcoRI dały fragmenty DNA podobnej wielkości, a DNA Jeffa i kontrola pozytywna zostały pocięte prawie identycznie przez HindIII, podczas gdy kontrola negatywna została pocięta inaczej. Wyniki te doprowadziły do ​​akceptacji hipotezy, co oznacza, że ​​u Jeffa zdiagnozowano mukowiscydozę spowodowaną mutacją CFTR ∆F508.

Wstęp

U zdrowych osób organizm reaguje na infekcje dróg oddechowych poprzez zwiększenie poziomu śluzu w płucach i drogach oddechowych. Jednak śluz ten może również zatrzymywać bakterie i obcy materiał, więc białko regulatora przewodnictwa przezbłonowego mukowiscydozy (CFTR) transportuje sole, w tym jony chloru, jony wodorowęglanowe i aniony przez nabłonkowe komórki płuc, aby nawodnić płuca i usunąć nadmiar śluzu (Gentzsch, 2018 Southern i wsp. 2018).

Istnieje jednak ponad 2000 mutacji genu CFTR, które mogą powodować śmiertelną chorobę mukowiscydozy (Southern i wsp. 2018). Te mutacje CFTR są pogrupowane w pięć różnych klas w zależności od tego, jak wpływają na białko CFTR: Mutacje klasy I wytwarzają dysfunkcjonalne białko CFTR poprzez dodanie wczesnego kodonu stop do sekwencji genetycznej, mutacje klasy II wytwarzają nieprawidłowe białko CFTR, z których większość jest zdegradowana przez komórkę, zanim dotrze do wyściółki płuc, mutacje klasy III wytwarzają białka CFTR, które nie mogą przenosić jonów przez nabłonkowe komórki płuc, mutacje klasy IV wytwarzają upośledzone białka CFTR, które mają trudności z transportem jonów przez komórki nabłonkowe płuc, mutacje klasy V wytwarzają funkcjonalne Białko CFTR, ale w mniejszych ilościach niż zwykle, co zmniejsza jego wydajność (Southern i wsp. 2018).

Najczęstszą z mutacji CFTR, odpowiedzialną za 90% przypadków mukowiscydozy (Cooney, 2018) jest defekt klasy II zwany mutacją ∆F508, ta specyficzna mutacja występuje, gdy fenyloalanina jest usunięta w pozycji 508 genu CFTR (Suaud et al. al. 2011). Jest to bardzo powszechna i śmiertelna choroba autosomalna recesywna, która dotyka 1 na 2000 mieszkańców Ameryki Północnej lub 70 000 osób na całym świecie (Cutting, 2015 Southern et al. 2018). Choroba ta jest śmiertelna z powodu dysfunkcjonalnego białka CFTR, co oznacza, że ​​śluz gromadzi się w płucach i przewodach trzustkowych, który wychwytuje bakterie, osłabia układ odpornościowy, uszkadza narządy, powoduje stan zapalny i często prowadzi do cukrzycy i/lub niedożywienia, zwykle u pacjentów umierają z powodu niewydolności oddechowej (Cutting, 2015 Southern et al. 2018). Na szczęście istnieje kilka metod leczenia, które łagodzą skutki tej choroby i przedłużają życie dotkniętych nią osób, a ponieważ mukowiscydoza jest spowodowana jedynie mutacjami w genie CFTR, stosunkowo łatwo jest przetestować i zdiagnozować pacjentów (Cutting, 2015).

Te jednogenowe zaburzenia autosomalne recesywne (Cutting, 2015) tworzą rodzaj zmienności genetycznej genu CFTR w populacji zwanej polimorfizmem (Pare, 2012). Jednym z najczęstszych sposobów diagnozowania polimorfizmów pojedynczej mutacji jest technika zwana analizą polimorfizmu długości fragmentów restrykcyjnych (RFLP), która wykorzystuje endonukleazy restrykcyjne do cięcia sekwencji DNA na fragmenty w określonych miejscach, aby pomóc naukowcom w identyfikacji wariacji genetycznych (Loenen i in. 2014 Sapienza, 2012). Endonukleazy restrykcyjne to enzymy, które są naturalnie wytwarzane w kilku gatunkach prokariontów, ale mają wiele zastosowań w laboratoryjnych eksperymentach genetycznych (Pingoud i wsp. 2014). Endonukleazy restrykcyjne lub REazy są podzielone na cztery kategorie (Typ I, Typ II, Typ III i Typ IV), najczęściej stosowanymi w testach genetycznych są REazy Typu II, które działają poprzez przecinanie pasm fosforanowych na lub w pobliżu sekwencji rozpoznawanej w DNA , proces ten wytwarza spójne fragmenty DNA (Pingoud i wsp. 2014 Sapienza, 2012).

Dwie z najlepiej poznanych REaz Typu II obejmują EcoRI i HindIII: EcoRI, który został odkryty z Escherichia coli, a HindIII został odkryty z Haemophilus influenzae rd (Pingoud i in. 2014). W szczególności EcoRI i Hindlll lokalizują swoje specyficzne, rozłożone naprzemiennie sekwencje rozpoznawane przez nukleotydy i rozszczepiają wiązania fosforanowe między nukleotydami: EcoRI rozpoznaje GAATTC i rozcina wiązanie fosforanowe między G i A, dodatkowo rozpoznaje i przecina dowolne sekwencje różniące się jedną zasadą- pary, HindIII rozpoznaje AAGCTT i rozszczepia wiązanie fosforanowe między dwoma A (Loenen i wsp. 2014 Sapienza, 2012). Dodatkowo, ponieważ te dwie REazy wytwarzają symetryczne naprzemienne nacięcia, fragmenty DNA mogą przyłączać się do ich komplementarnej nici, co zostało wykorzystane do zastosowań w klonowaniu genetycznym (Loenen et al. 2014). Gdy EcoRI dodaje się do próbki DNA krwi lub śliny pacjenta z lub bez mutacji CF∆F508, EcoRI tnie gen CFTR dwukrotnie, aby wytworzyć trzy fragmenty, które mają 2150 pz, 2150 pz i 4700 pz. Jednak HindIII daje różne wyniki po dodaniu do próbki DNA krwi lub szałwii pacjentów z i bez mutacji CF∆F508. U pacjentów bez mutacji CF∆F508, HindIII tnie gen CFTR dwukrotnie, aby wytworzyć trzy fragmenty, które mają 1500 pz, 5700 pz i 1800 pz. Z drugiej strony, u pacjentów z mutacją CF∆F508, HindIII nie identyfikuje rozpoznawanej sekwencji na 1500 pz, ponieważ delecja fenyloalaniny w pozycji 508 zaburza resztę sekwencji, więc zamiast tego HindIII tnie gen CFTR tylko w celu wytworzenia dwa fragmenty o wielkości 7200 pz i 1800 pz. Powodem, dla którego Hindlll daje różne wyniki u pacjentów z mutacją i bez mutacji, podczas gdy EcoRI daje identyczne wyniki, jest to, że Hindlll jest bardziej specyficzny i może identyfikować tylko sekwencje dokładnego rozpoznawania, podczas gdy EcoRI jest nieco mniej specyficzny i może identyfikować nieco różne sekwencje. Wyniki analizy RFLP można analizować za pomocą elektroforezy w żelu agarozowym, do próbek DNA dodaje się barwnik fluorescencyjny, aby fluoryzował pod transiluminatorem UV, aby ujawnić odległość, jaką przebyły fragmenty. Odległość, jaką pokonują próbki, jest proporcjonalna do ich długości, dlatego odległości, które przemierzają fragmenty DNA markera, mogą być użyte do stworzenia równania z krzywej standardowej, która wykorzysta odległości, które przebyły inne próbki DNA, aby określić ich rozmiar cząsteczkowy.

Ten eksperyment będzie testował adoptowanego 3-latka o imieniu Jeff na mukowiscydozę wywołaną mutacją CFTR ∆F508. Aby ustalić, czy Jeff ma mukowiscydozę, jego DNA zostanie poddane analizie RFLP z użyciem endonukleaz restrykcyjnych EcoRI i HindIII. Kontrola pozytywna (pacjent z mutacją ∆F508) i kontrola negatywna (pacjent bez mutacji ∆F508) również zostaną poddane analizie RFLP z EcoRI i HindIII, aby wyniki Jeffa można było z czymś porównać. Wyniki analizy RFLP będą wizualizowane przez elektroforezę w żelu agarozowym, a następnie równanie otrzymane z krzywej standardowej zostanie użyte do obliczenia wielkości cząsteczkowych fragmentów DNA po ich pocięciu przez REazy. Ustalenie, czy Jeff ma mukowiscydozę i jaki rodzaj mutacji jest wywołany mukowiscydozą, jest ważne, aby mógł otrzymać najlepsze leczenie, aby mógł żyć bez bólu i przedłużyć życie.

Przypuszcza się, że Jeff ma mukowiscydozę, ponieważ wykazuje kilka objawów związanych z mukowiscydozą, w tym świszczący oddech, trzaski, uporczywy kaszel, tłuste stolce i katar. Ponadto, ponieważ mukowiscydoza spowodowana mutacją CFTR ∆F508 jest chorobą autosomalną recesywną, możliwe jest, że oboje jego rodzice byli nosicielami mutacji i że odziedziczył on dwa zmutowane allele, to wyjaśnia, dlaczego jego rodzice nie mieli historii medycznej z mukowiscydozą. zwłóknienie.

Jeśli ta hipoteza jest poprawna, a Jeff ma mukowiscydozę spowodowaną mutacją CFTR ∆F508, to przewiduje się, że gdy jego DNA zostanie przecięte przez EcoRI dwa razy, aby wytworzyć trzy prążki o masie cząsteczkowej 2150 pz, 2150 pz i 4700 pz i że jego DNA zostanie raz przecięty przez HindIII w celu wytworzenia dwóch prążków o masach cząsteczkowych 7200 pz i 1800 pz. Również kontrole (pacjenci z i bez mutacji ∆F508) będą również cięte przez EcoRI dwa razy w celu wytworzenia trzech prążków o masach cząsteczkowych 2150 pz, 2150 pz i 4700 pz. Dlatego DNA Jeffa i pacjenci z mutacją ∆F508 i bez niej będą mieli prążki o identycznej masie cząsteczkowej po przecięciu przez EcoRI. Dodatkowo, kontrola pozytywna (pacjent z mutacją ∆F508) zostanie również raz przecięta przez HindIII w celu wytworzenia dwóch prążków o masach cząsteczkowych 7200 pz i 1800 pz. Natomiast kontrola negatywna (pacjent bez mutacji ∆F508) zostanie dwukrotnie przecięta w celu wytworzenia trzech prążków o masach cząsteczkowych 5700 pz, 1800 pz i 1500 pz. Oznacza to, że prążki, które pojawiają się, gdy próbka DNA Jeffa jest przecięta HindIII, powinny mieć identyczną wagę jak u pacjenta z mutacją ∆F508, którego DNA zostało również przecięte HindIII, a obie te próbki powinny być inne niż w przypadku stosowania HindIII pacjent, który nie ma mutacji ∆F508.

Materiały

Na początek uzyskano sześć próbek DNA: dwie próbki od pacjenta badanego pod kątem mukowiscydozy (Jeff), dwie próbki od osoby z mutacją ∆F508 i dwie próbki od osoby bez mutacji ∆F508. Próbki od osobnika z mutacją ∆F508 zostały uprzednio pocięte odpowiednio EcoRI i Hindlll, nic więcej nie dodano do tych próbek, dopóki nie dodano barwnika obciążającego. Bufor reakcyjny połączono z innymi próbkami, a następnie dodano EcoRI do jednej próbki DNA osobnika bez mutacji ∆F508 i do jednej próbki DNA Jeffa. Następnie HindIII dodano do jednej próbki DNA osobnika bez mutacji ∆F508 i do jednej próbki DNA Jeffa. Te cztery próbki inkubowano w 37 stopniach Celsjusza przez trzydzieści minut. Przygotowano roztwór 0,8% żelu agarozowego z agarozą, 1x buforem TAE i 10000x barwnikiem żelowym Sybr Safe DNA. Ten roztwór wylano na tacę z żelem zamkniętą w stojaku odlewniczym, dodano grzebień, a następnie żel umieszczono w lodówce na trzydzieści minut w celu zestalenia. Grzebień usunięto, a następnie tacę żelową ze stałym żelem opuszczono do komory elektroforetycznej i zanurzono w buforze 1x TAE. Do każdej z sześciu próbek DNA dodano barwnik obciążający zawierający Ficol. Marker załadowano do pierwszego dołka/ścieżki, aby wyświetlić prążki o następujących wielkościach cząsteczkowych: 12 000 pz, 7000 pz, 3000 pz, 2500 pz, 2000 pz, 1800 pz i 1500 pz. Następnie sześć próbek DNA pociętych EcoRI lub Hindlll załadowano do oddzielnych studzienek. Pokrywę umieszczono na komorze elektroforetycznej tak, aby ładunek biegł od ujemnego do dodatniego końca, aparat pozostawiono na 45 minut przy 120 V, aż należność znalazła się w połowie żelu. Żel wyjęto z aparatu i oglądano na transiluminatorze UV ​​obok linijki, aby można było zmierzyć odległość, jaką przebył każdy barwnik. Utworzono wykres krzywej standardowej z danymi z pomiarów markera. Równanie, które wygenerował ten wykres, zostało użyte do przybliżenia wielkości cząsteczkowej prążków z sześciu próbek DNA. (DeCicco-Skinner, 2019).

Wyniki

Rysunek 1: Wyświetlanie żelu na górze transiluminatora UV obok linijki metrycznej. Linia 1 zawierała marker i produkowała 7 widocznych prążków, linia 2 zawierała -E (DNA pacjenta bez mutacji ∆F508, cięte EcoRI), linia 3 zawierała +E (DNA pacjenta z mutacją ∆F508, cięte EcoRI), linia 4 zawierała JE (DNA Jeffa cięte EcoRI), linia 5 zawierała -H (DNA pacjenta bez mutacji ∆F508, cięte HindIII), linia 6 zawierała +H (DNA pacjenta z ∆F508 mutacja, przecięta HindIII), linia 7 zawierała JH (DNA Jeffa cięte HindIII). Ścieżki 2, 3 i 4 dały po dwa prążki, które były prawie identyczne w trzech dołkach. Linia 5 wyprodukowała cztery zespoły. Tory 6 i 7 wyprodukowały dwa pasma, które były prawie identyczne.

Odległość, jaką prążki przebyły na żelu, mierzono od odległości między studzienką a dnem prążka. Marker z toru 1 zawierał pasma o kilku masach cząsteczkowych: pasmo 12.000 pz przebyło 21,5 mm, pasmo 7000 pz przebyło 26,5 mm, pas 3000 pz przebyło 29,2 mm, pas 2500 pz przebyło 34,4 mm, pas 2000 pz przebyło 37,9 mm, pas 1800 pz przesunął się o 40,5 mm, a pas 1500 pz przesunął się o 44,1 mm (ryc. 1). Ścieżka 2 została obciążona DNA pacjenta bez mutacji ∆F508, którą wycięto EcoRI, ścieżka 2 wykazywała dwa prążki: jeden przebył 28,1 mm, a drugi 35,2 mm (Figura 1).Ścieżka 3 została załadowana DNA pacjenta z mutacją ∆F508, która została pocięta za pomocą EcoRI, ścieżka 3 również miała dwa prążki: jeden przebył 27,8 mm, a drugi 36,1 mm (Figura 1). Ścieżka 4 została załadowana DNA Jeffa i została pocięta za pomocą EcoRI, ścieżka 4 również miała dwa prążki w prawie tym samym miejscu co poprzednie dwie studzienki: jeden prążek przesunął się 28,0 mm, a drugi 35,9 mm (ryc. 1). Ścieżka 5 została załadowana DNA pacjenta bez mutacji ∆F508, która została przecięta HindIII, ścieżka 5 miała cztery prążki przemieszczające się 27,8 mm, 35,8 mm, 42,3 mm i 44,1 mm (Figura 1). Ścieżka 6 została obciążona DNA pacjenta z mutacją ∆F508, która została przecięta HindIII, ścieżka 6 miała dwa pasma przemieszczające się 26,1 mm i 43,5 mm (Figura 1). Linia 7 została załadowana DNA Jeffa i została pocięta HindIII, linia 7 miała dwa prążki, które były bardzo podobne do linii 6, podróżując 26,0 mm i 43,5 mm (ryc. 1).

Figura 2: Wyświetlanie krzywej standardowej dla trawienia restrykcyjnego CFTR ∆F508. Log masy cząsteczkowej każdego prążka markera wykreślono na osi y, a odległość w milimetrach, o jaką każdy prążek migrował ze studzienki, do której załadowano marker, wykreślono na osi x. Z tych danych dodano liniową linię trendu, obliczono i wyświetlono równanie linii najlepszego dopasowania (y=-0,0391x + 4,8133) oraz obliczono i wyświetlono współczynnik determinacji (R^2=0,8987).

Pomiary zebrane z rysunku 1 zostały wykorzystane do stworzenia wykresu krzywej standardowej na rysunku 2. Dodanie liniowej linii trendu dało równanie linii najlepszego dopasowania (y=-0,0391x + 4,8133) i dało współczynnik determinacji 0,8987 . Do tego równania włączono odległość, jaką przebył każdy prążek dla sześciu próbek, a następnie zastosowano antylog, aby obliczyć przybliżony rozmiar prążka.

Tabela 1: Trawienie restrykcyjne mutacji CFTR ∆F508 przez EcoRI i HindIII dla Jeffa, pacjenta z mutacją CFTR ∆F508 i pacjenta bez mutacji CFTR ∆F508.
Tabela 1: Przedstawienie oczekiwanej względem obserwowanej masy cząsteczkowej dla markera i sześciu próbek DNA ciętych EcoRI lub Hindlll. Masę cząsteczkową każdej próbki obliczono z równania krzywej standardowej (y=-0,0391x + 4,8133). Linie 2, 3 i 4 miały pasma o bardzo podobnych rozmiarach, a wartości były zbliżone do oczekiwanych. Linia 5 miała więcej pasm niż oczekiwano. Pasy 6 i 7 miały pasma, które były bardzo podobne i bliskie tego, czego oczekiwano.

Z równania na Figurze 2 obliczono obserwowane rozmiary prążków dla sześciu próbek DNA i zanotowano w Tabeli 1. Obserwowane rozmiary prążków obliczono również dla markera, aby można było określić ilościowo wielkość błędu. Tabela 1 pokazuje, że obliczona masa cząsteczkowa jest inna niż oczekiwana masa cząsteczkowa, ta różnica jest najbardziej zauważalna, gdy prążek ma więcej par zasad. Oznacza to, że obserwowany rozmiar prążka dla próbek DNA nie powinien dokładnie odpowiadać oczekiwanemu rozmiarowi prążka i że wartość będzie najdokładniejsza dla prążków z mniejszą liczbą par zasad. W przypadku trzech próbek DNA pociętych EcoRI (pacjenci z (+E) i bez (-E) mutacją CFTR ΔF508 i Jeff (JE)) oczekiwano, że EcoRI przetnie nić DNA dwukrotnie, aby wytworzyć trzy prążki: dwa prążki, które miały 2150 pz i jeden prążek, który miał 4700 pz. Jednak obserwacja tych próbek ujawniła tylko dwa prążki. Pacjent -E miał wyliczone prążki 2500 pz, a pacjent +E 5183 pz miał wyliczone prążki 2522 pz, a pacjent JE 5325 pz miał wyliczone prążki 2568 pz i 5229 pz. Wartości te są bardzo zbliżone i zasadniczo identyczne. Oczekiwano, że pacjent bez mutacji CFTR ΔF508 (-H), którego DNA przecięto Hindlll, zostanie przecięty dwukrotnie w celu wytworzenia trzech prążków: 1500 pz, 5700 pz i 1800 pz. Zaobserwowano jednak cztery prążki wskazujące, że DNA zostało pocięte w czterech miejscach. Dało to prążki, które obliczono na 1227 pz, 1443 pz, 2591 pz i 5325 pz. Oczekiwano, że pacjent z mutacją CFTR ΔF508 (+H) i Jeff (JH), którego DNA pocięto HindIII zostanie przecięty raz, aby wytworzyć dwa prążki, które miały 7200 pz i 1800 pz. W rzeczywistości te dwie próbki pocięto raz, u pacjenta +H rozmiary prążków wynosiły 6206 pz i 1296 pz, podczas gdy u pacjenta z JH rozmiary prążków wynosiły 6262 pz i 1296 pz. Wartości te są tak podobne, że rozmiary pasków można uznać za identyczne.

Dyskusja

Z ponad 2000 polimorfizmami mutacji związanych z mukowiscydozą, z pewnością wiele może się nie udać w przypadku genu CFTR. W przykładzie mutacji CFTR ∆F508 usunięto pojedynczy aminokwas (fenyloalaninę) w pozycji 508 genu (Suaud i wsp. 2011). Delecja fenyloalaniny w tej pozycji jest tak poważna, że ​​białko CFTR staje się dysfunkcyjne, powodując nadprodukcję śluzu na powierzchni nabłonka (Kreda i wsp. 2012). Białko CFTR zostało zidentyfikowane w kilku eksperymentach jako kanał anionowy aktywowany przez cykliczną fosforylację zależną od adenozynomonofosforanu (cAMP), który transportuje sole (jony chlorkowe i jony wodorowęglanowe) i inne aniony przez komórki nabłonka (Gentzsch, 2018). Zdrowe, w pełni funkcjonalne białka CFTR transportują te sole przez błonę komórkową nabłonka wyścielającego płuca i inne narządy, aby usunąć nadmiar śluzu poprzez nawodnienie powierzchni (Gentzch, 2018 Suaud i wsp. 2011). W przypadku mutacji CFTR ∆F508 wytwarzane jest nieprawidłowe białko CFTR, które nie może się prawidłowo zwinąć, białko nie może się zwijać, ponieważ odcinek CFTR, który oddziałuje z ATP, aby wiązać nukleotydy zwane domeną wiążącą nukleotydy (NBDI) i czwartą pętlą cytozolową w innej sekcji CFTR, która zakotwicza inne białko w błonie komórkowej (MSD 2), tworzą wiązania wodorowe z aminokwasem argininy w kodonie 1070 (Cutting, 2015). Komórka wykrywa nieprawidłowo sfałdowane białka CFTR i degraduje większość z nich w retikulum endoplazmatycznym (Suaud i wsp. 2011). Oznacza to, że bardzo mało lub żadne białko CFTR nie dociera do powierzchni komórek nabłonka, dlatego jony chlorkowe i wodorowęglanowe nie mogą być transportowane przez błonę plazmatyczną (Suaud i wsp. 2011). Ponieważ te jony soli nie mogą być transportowane przez błonę plazmatyczną, sole są w większym stężeniu po stronie podstawnej komórek nabłonka, co powoduje odciąganie wody z powierzchni wierzchołkowej i prowadzi do odwodnienia powierzchni płuc, przewodu pokarmowego i trzustki (Gentzsch , 2018). Gdy nie ma wody na wierzchołkowych powierzchniach tych narządów, nadmiar śluzu nie może zostać usunięty, a gęsty, lepki śluz tworzy przeszkody i prowadzi do chorób układu oddechowego i zapalenia, które ostatecznie prowadzą do śmierci pacjentów (Gentzsch, 2018).

W tym eksperymencie zbadano 3-letniego Jeffa pod kątem mukowiscydozy spowodowanej mutacją CFTR ∆F508 przy użyciu analizy RFLP z użyciem endonukleaz restrykcyjnych EcoRI i HindIII. Jego wyniki porównano z kontrolą dodatnią (pacjent z mutacją ∆F508) i kontrolą ujemną (pacjent bez mutacji ∆F508), które również zostały włączone do analizy RFLP z EcoRI i HindIII, aby wyniki Jeffa można było z czymś porównać. Wyniki analizy RFLP wizualizowano za pomocą elektroforezy na żelu agarozowym (Rysunek 1), a następnie sporządzono równanie z krzywej standardowej (Rysunek 2), której użyto do obliczenia wielkości cząsteczkowych (Tabela 1) fragmentów DNA, które wytworzone endonukleazy. Ta wczesna diagnoza ma kluczowe znaczenie dla zapewnienia Jeffowi opieki, której potrzebuje, aby mógł żyć bezboleśnie i długo. Co więcej, analiza RFLP jest znacznie bardziej niezawodną metodą testowania zaburzeń autosomalnych recesywnych niż testy genetyczne bezpośrednio skierowane do konsumentów, takie jak 23andMeTM, ponieważ jest mniej miejsca na nieporozumienia. Firmy takie jak 23andMeTM mierzą zmienność genetyczną, porównując informacje genetyczne klienta z ich bazą danych mutacji, ta baza danych może wykryć 715 000 mutacji pojedynczego nukleotydu (Lu i wsp. 2017). Oznacza to, że baza danych wykryłaby delecję trzech nukleotydów, która występuje, gdy fenyloalanina jest usunięta w pozycji 508 genu CFTR. RFLP różni się od tego, ponieważ nie porównuje sekwencji genetycznych, a raczej wykorzystuje endonukleazy restrykcyjne do cięcia DNA na fragmenty w rozpoznawanych sekwencjach, w tym przypadku mukowiscydozę można zdiagnozować, jeśli DNA pacjenta zostało pocięte w tych samych miejscach, co kontrola pozytywna. Jedną z zalet testów genetycznych, takich jak te dostarczane przez 23andMeTM, jest to, że mogą one również stwierdzić, czy pacjent jest nosicielem mutacji recesywnej, czego nie może zrobić analiza RFLP (Lu i wsp. 2017). Jednak jedną z największych obaw związanych z bezpośrednimi testami genetycznymi jest to, że większość ludzi nie wie, jak interpretować wyniki i może podejmować drastyczne zachowania w wyniku nieotrzymania porady genetycznej (Pare, 2012), jest to kolejny powód dlaczego ważne jest, aby testować na mukowiscydozę za pomocą RFLP zamiast 23andMeTM.

Postawiono hipotezę, że Jeff ma mukowiscydozę spowodowaną mutacją CFTR ∆F508, ponieważ wykazuje kilka objawów związanych z chorobą. Byłoby to możliwe, gdyby oboje jego rodzice byli nosicielami mutacji CFTR ∆F508, ponieważ nosiciele nie mają objawów, ponieważ choroba występuje tylko wtedy, gdy oba allele w tej lokalizacji genu CFTR są zmutowane. Przewidywano, że gdy DNA Jeffa zostanie przecięte przez EcoRI dwa razy, tworząc trzy prążki o rozmiarach 2150 pz, 2150 pz i 4700 pz, a jego DNA zostanie przecięte przez HindIII po wytworzeniu dwóch prążków o rozmiarach 7200 pz i 1800 pz . Ponadto próbki EcoRI (pacjenci z i bez mutacji ∆F508) zostałyby pocięte przez EcoRI dwa razy w identyczny sposób jak DNA Jeffa, dając trzy prążki o rozmiarach 2150 pz, 2150 pz i 4700 pz. Oznacza to, że DNA Jeffa i DNA pacjentów z mutacją ∆F508 i bez niej powinny mieć prążki o identycznej wielkości po przecięciu przez EcoRI. Dodatkowo, kontrola pozytywna (pacjent z mutacją ∆F508) również zostałaby raz przecięta przez HindIII, podobnie jak DNA Jeffa wytwarzające dwa prążki o rozmiarach 7200 pz i 1800 pz. Pozostaje to w kontraście do kontroli negatywnej (pacjent bez mutacji ∆F508), której DNA przewidywano do dwukrotnego przecięcia, dając trzy prążki o rozmiarach 5700 pz, 1800 pz i 1500 pz. Jeśli hipoteza jest prawidłowa, to prążki, które pojawiają się, gdy próbka DNA Jeffa jest przecięta HindIII będą miały identyczną wagę jak pacjent z mutacją ∆F508, którego DNA zostało również przecięte HindIII, a obie te próbki powinny być inne niż w przypadku HindIII zastosowano u pacjenta, który nie ma mutacji ∆F508.

Celem włączenia kontroli pozytywnej było to, aby wyniki trawienia restrykcyjnego HindIII osobnika z mutacją ∆F508 można było zwizualizować, a następnie porównać z tym, jak pocięto DNA Jeffa, jeśli zostały pocięte w ten sam sposób, oznacza to, że ma on również taki sam Polimorfizm CFTR. Jeśli jego DNA jest cięte inaczej niż kontrola pozytywna, oznaczałoby to, że nie ma mutacji ∆F508. Celem włączenia kontroli negatywnej było umożliwienie wizualizacji wyników trawienia restrykcyjnego Hindlll osobnika bez mutacji ∆F508, a następnie porównanie z tym, jak pocięto DNA Jeffa. Jeśli kontrola negatywna zostałaby przecięta inaczej niż zarówno kontrola pozytywna, jak i DNA Jeffa, oznaczałoby to, że nie ma on mutacji ∆F508. Jeśli jednak wyniki Jeffa nie pasują ani do dodatnich, ani ujemnych, oznaczałoby to, że wyniki eksperymentu są nieprawidłowe. Ponadto, jeśli kontrola pozytywna i negatywna są identyczne po cięciu HindIII, wyniki eksperymentalne byłyby nieważne. Ponadto, mimo że wyniki analizy RFLP będą takie same dla Jeffa i kontroli podczas cięcia za pomocą EcoRI, EcoRI nadal był uwzględniany, ponieważ jeśli nie dałoby to identycznych wyników dla wszystkich próbek, to wyniki eksperymentu byłyby zakwestionować.

Marker, który został załadowany na ścieżkę 1, z powodzeniem przemieszczał się po żelu (Figura 1) i wytwarzał prążki o 12 000 pz, 7000 pz, 3000 pz, 2500 pz, 2000 pz, 1800 pz i 1500 pz zgodnie z oczekiwaniami (Tabela 1). Zmierzono odległość, na jaką migrował każdy prążek, a dane te wykreślono w funkcji logarytmu każdej masy cząsteczkowej, aby uzyskać krzywą standardową, która dała współczynnik determinacji 0,8987 i linię najlepszego dopasowania z równaniem y=-0,0391x +4,8133 (Rysunek 2 ). Do tego równania włączono odległość, jaką przebył każdy prążek dla sześciu próbek, a następnie zastosowano antylog, aby obliczyć przybliżony rozmiar prążka. Równanie to zostało użyte do obliczenia wielkości markerów, a także do określenia, jak duży błąd matematyczny występuje w tym modelu. Tabela 1 pokazuje, że obliczona masa cząsteczkowa jest nieco inna niż rzeczywista masa cząsteczkowa, efekt ten jest wzmocniony, gdy DNA ma więcej par zasad. Oznacza to, że wyniki innych próbek DNA mogą również wykazywać pewną zmienność między oczekiwaną a obserwowaną masą cząsteczkową prążków i że nawet przy takiej zmienności wyniki będą nadal ważne. To równanie zostało również użyte do obliczenia rozmiarów cząsteczek prążków pokazanych na żelu na Ryc. 1. Jeśli hipoteza jest poprawna, to DNA Jeffa, pacjent z mutacją ∆F508 i pacjent bez mutacji ∆F508 zostaną odcięci. dwukrotnie przez EcoRI w celu wytworzenia prążków o masach cząsteczkowych 2150 pz, 2150 pz i 4700 pz. Ponieważ dwa z tych prążków mają tę samą masę cząsteczkową, na żelu pojawią się tylko dwa prążki: 2150 pz i 4700 pz. Obserwacja tych próbek DNA wykazała, że ​​wszystkie mają dwa prążki (ryc. 1 – ścieżki 2,3,4), a obliczenia z równania krzywej standardowej wykazały, że masa cząsteczkowa tych dwóch prążków w trzech próbkach była bardzo podobna: w JE wielkości fragmentów DNA obliczono jako 2568 bp i 5229 bp w -E, wielkości prążków obliczono jako 2500 bp i 5183 bp w +E, wielkości prążków obliczono jako 2522 bp i 5325 bp (Tabela 1). Ponieważ EcoRI przecina wszystkie próbki w przybliżeniu w tym samym miejscu, można wywnioskować, że analiza RFLP działała poprawnie i że inne wyniki eksperymentu również powinny działać poprawnie. Oznacza to również, że gen CFTR był faktycznie obecny we wszystkich próbkach DNA, ponieważ gdyby w którejkolwiek z próbek brakowało genu CFTR, próbki nie wytworzyłyby identycznych fragmentów DNA. Jednak same te wyniki nie mogą dostarczyć diagnozy mukowiscydozy, ponieważ enzym EcoRI tnie kontrolę pozytywną i negatywną w ten sam sposób. Gdyby EcoRI i kontrola pozytywna były jedynymi rzeczami użytymi do zdiagnozowania Jeffa, to hipoteza zostałaby zaakceptowana, ponieważ gen CFTR jest pocięty na te same fragmenty DNA dla kontroli pozytywnej i Jeffa. Paradoksalnie, gdyby EcoRI i kontrola negatywna były jedynymi rzeczami użytymi do zdiagnozowania Jeffa, hipoteza zostałaby odrzucona, ponieważ gen CFTR jest cięty na te same fragmenty DNA dla kontroli negatywnej i Jeffa. Oczywiście jest to problematyczne, ponieważ hipoteza nie może być zarówno zaakceptowana, jak i odrzucona, dlatego w celu dokładnej diagnozy Jeffa z mukowiscydozą należy zastosować endonukleazę restrykcyjną, która w różny sposób przecina kontrolę pozytywną i negatywną, dlatego też zastosowano HindIII.

Jeśli hipoteza byłaby poprawna, wówczas DNA Jeffa i pacjent (kontrola pozytywna) z mutacją ∆F508 zostaliby przecięti raz przez HindIII w celu wytworzenia prążków o masach cząsteczkowych 7200 pz i 1800 pz. Obserwacja tych próbek DNA wykazała, że ​​obydwie zostały przecięte raz i miały dwa prążki (ryc. 1 – ścieżki 6 i 7) a obliczenia z równania krzywej standardowej wykazały, że masa cząsteczkowa tych dwóch prążków w obu próbkach była podobna: w JH rozmiary prążków obliczono jako 6262 pz i 1296 pz, aw +H rozmiary prążków obliczono jako 6206 pz i 1296 pz (Tabela 1). Ponieważ HindIII przecina zarówno DNA Jeffa, jak i DNA pacjenta, który ma mutację ∆F508, prawdopodobne jest, że Jeff ma również mutację ∆F508, która powoduje mukowiscydozę. Aby potwierdzić, że te wyniki są prawidłowe, obie próbki należy porównać z kontrolą ujemną – pacjent bez mutacji CFTR ∆F508. Obserwacja wykazała, że ​​DNA pacjenta (-H) bez mutacji ∆F508 zostało trzykrotnie przecięte przez HindIII w celu wytworzenia czterech prążków (Figura 1) i obliczono, że te prążki mają masy cząsteczkowe 1227 pz, 1443 pz, 2591 pz i 5325 pz (tabela 1). Oczywiście wyniki te nie zgadzają się z przewidywaniami, że DNA tego pacjenta zostanie dwukrotnie przecięte przez HindIII, aby wytworzyć trzy prążki o masach cząsteczkowych 5700 pz, 1800 pz i 1500 pz. Jednak dwa górne prążki wydają się być wyrównane z prążkami z próbek ciętych EcoRI. Oznacza to, że ta próbka była prawdopodobnie zanieczyszczona jakimś EcoRI. Koliduje to z analizą wyników, jednak nadal można wyciągnąć pewne wnioski ze względu na umiejscowienie tych prążków w stosunku do innych próbek HindIII. Po pierwsze, wyniki są na tyle różne, że można wywnioskować, że JH i +H były identyczne, podczas gdy -H było różne. Po drugie, próbka -H ma prążek, który znajduje się poniżej najniższego prążka w +H i JH (rysunek 1 – ścieżki 5, 6, 7). Miałoby to sens, gdyby hipoteza była poprawna, ponieważ -H powinien mieć najmniejszy prążek 1500 pz, a +H/JH powinien mieć najmniejszy prążek 1800 pz (Tabela 1). Po trzecie, jedynym sposobem, w jaki próbka DNA Jeffa mogłaby zostać pocięta przez HindIII na 7200 pz byłoby, gdyby miał mutację CFTR ∆F508 (Rysunek 1 i Tabela 1). W związku z tym hipoteza jest akceptowana, Jeff ma mukowiscydozę spowodowaną mutacją CFTR ∆F508.

Gdyby kontrola pozytywna została pominięta, diagnoza byłaby bardzo trudna do postawienia i hipoteza nie mogłaby zostać potwierdzona, ponieważ obliczona wielkość molekularna fragmentów DNA Jeffa jest inna niż oczekiwana wielkość molekularna. Obserwacja, że ​​obliczona wielkość molekularna również różniła się od oczekiwanej wielkości fragmentów DNA kontroli pozytywnej i że wielkość molekularna tych fragmentów i fragmentów Jeffa była prawie identyczna po cięciu HindIII była ostatecznym czynnikiem, który doprowadził do przyjęcia hipotezy. Gdyby kontrola negatywna została pominięta, hipoteza byłaby nadal zaakceptowana, ponieważ DNA Jeffa nadal pasowałoby do kontroli pozytywnej. Jednak w alternatywnym scenariuszu, w którym nie miał on mukowiscydozy, brak kontroli negatywnej oznaczałby, że niemożliwe byłoby potwierdzenie, że Jeff nie miał mukowiscydozy, ponieważ jego fragmenty DNA nie pasowałyby do niczego po cięciu przez HindIII.

W tym eksperymencie wykorzystano tylko segment genomu Jeffa, który zawierał gen CFTR. Gdybyśmy użyli jego całego genomu pacjenta z mutacją lub bez mutacji, wówczas EcoRI i Hindlll zlokalizowałyby znacznie więcej miejsc rozpoznania (odpowiednio GAATTC i AAGCTT) i rozszczepiły grupy fosforanowe w tych miejscach, to dałoby o wiele więcej fragmentów DNA. W rzeczywistości jest tak wiele fragmentów DNA, że trudno byłoby powiedzieć, na co patrzysz. Zamiast kilku prążków na rycinie 1 zamiast tego mogą być setki prążków. Uniemożliwiłoby to określenie, czy Jeff miał mutację w CFTR. Protokół laboratoryjny musiałby zostać zmodyfikowany, gdyby wykorzystano całe genomy, aby można było zbadać określony region DNA.Jednym ze sposobów osiągnięcia tego jest metoda Southerna: fragmenty DNA z elektroforezy są przenoszone na membranę przez przeniesienie kapilarne w górę, a następnie unieruchamiane, umożliwiając identyfikację prążków pasujących do sekwencji CFTR za pomocą sondy (Brown, 2001).

Podsumowując, odkrycia te są znaczące, ponieważ ujawniają, że Hindlll jest bardzo przydatną endonukleazą restrykcyjną do diagnozowania mukowiscydozy, a diagnoza mukowiscydozy Jeffa (spowodowana mutacją CFTR ∆F508) oznacza, że ​​może on otrzymać spersonalizowane leczenie, na przykład lumakaftorem, jest lekiem, który może przynieść korzyści Jeffowi, zapobiegając degradacji nieprawidłowo sfałdowanych białek CFTR spowodowanej mutacją CFTR ∆F508, pomaga to białkom dotrzeć do wierzchołkowej powierzchni komórek nabłonka, dzięki czemu funkcja może zostać częściowo przywrócona (Kreda i wsp. 2012). Ten eksperyment można ulepszyć, podwajając liczbę próbek, aby upewnić się, że próbki nie zostały zanieczyszczone nieprawidłową endonukleazą restrykcyjną, oraz stosując inną linię trendu, która generuje równanie, które oblicza rozmiary cząsteczek z większą dokładnością. Przyszłe badania mogą zbadać zastosowanie innych endonukleaz restrykcyjnych, takich jak BamHI, EcoRII, Hand HaeIII, aby zobaczyć, jak obniżają one CFTR w kontrolach pozytywnych i negatywnych.

Bibliografia

Brown, T (2001) Southern Blotting. Curr Protoc Immunol 10(6a).

Cooney, A.L., P.B. McCray Jr i P.L. Sinn (2018) Terapia genowa mukowiscydozy: patrzenie wstecz, patrzenie w przyszłość. Geny (Bazylea) 9(11).

Cięcie, GR (2015) Genetyka mukowiscydozy: od zrozumienia molekularnego do zastosowania klinicznego. Nat Rev Genet 16 (1): 45-56.


Ważne pytania do CBSE Klasy 12 Biologia Zasady biotechnologii i narzędzia technologii rekombinacji DNA

1. Biotechnologia można zdefiniować jako wykorzystanie mikroorganizmów, roślin lub komórek zwierzęcych lub ich składników do wytwarzania produktów i procesów użytecznych dla ludzi. Według Europejskiej Federacji Biotechnologii (EFB) biotechnologia to integracja nauk przyrodniczych i organizmów, komórek, ich części i analogów molekularnych dla produktów i usług. Termin „biotechnologia” został ukuty przez Karla Ereky'ego w 1919 roku.
2. Zasady biotechnologii oparte są na koncepcji następujących technik:
(i) Inżynieria genetyczna jest techniką zmiany składu chemicznego materiału genetycznego (DNA/RNA), wprowadzenia go do innych organizmów, a tym samym zmiany fenotypu organizmu gospodarza.
(ii) Odpowiednie utrzymanie sterylnych warunków, aby wspierać wzrost tylko pożądanych drobnoustrojów/komórek eukariotycznych w dużych ilościach do wytwarzania produktów biotechnologicznych, takich jak antybiotyki, szczepionki, enzymy itp.

3. Techniki inżynierii genetycznej obejmują:

  • Stworzenie rekombinowany DNA łącząc pożądane geny.
  • Transfer genów.
  • Utrzymanie DNA w klonowaniu gospodarza i genów.
  • Podstawowe kroki w inżynierii genetycznej można podsumować jako:
  • Identyfikacja DNA z pożądanymi genami.
  • Wprowadzenie zidentyfikowanego DNA do gospodarza.
  • Utrzymanie wprowadzonego DNA w gospodarzu i przeniesienie DNA na jego potomstwo.

4. Konstrukcja pierwszego sztucznego rekombinowanego DNA
(i) Osiągnięto to poprzez połączenie genu kodującego oporność na antybiotyki z natywnym plazmid (autonomicznie replikujący się kolisty pozachromosomalny DNA) Salmonella typhimurium.
(ii) Stanley Cohen oraz Herbert Boyer dokonał tego w 1972 roku.
(iii) Wyizolowali gen oporności na antybiotyki wycinając fragment DNA z plazmidu.
(iv) Cięcie DNA w określonych miejscach zostało przeprowadzone przez nożyczki molekularne, tj. Enzymy restrykcyjne.
(v) Wycięty kawałek DNA został następnie połączony z DNA plazmidu za pomocą enzymu DNA ligaza. Plazmidowy DNA działa jako wektory przenieść dołączony do niego kawałek DNA.
(vi) Kiedy to DNA zostanie przeniesione do coli, może się replikować przy użyciu enzymu polimerazy DNA nowego gospodarza i tworzyć wiele kopii.
(vii) Ta zdolność do powielania kopii genu oporności na antybiotyki w mi. coli nazywano klonowanie genu oporności na antybiotyki w E. coli.

5. Narzędzia technologii rekombinacji DNA to:
(i) Enzymy restrykcyjne (ii) Enzymy polimerazy
(iii) Ligazy (iv) Wektory
(v) Właściwy organizm gospodarza.

6. Do cięcia DNA stosuje się enzymy restrykcyjne lub „molekularne nożyczki”.
(i) Dwa enzymy z E. coli, które były odpowiedzialne za ograniczenie wzrostu bakteriofaga, zostały wyizolowane w 1963 roku, jeden z nich dodał grupę metylową do DNA, a drugi pociął DNA na segmenty. Ten ostatni nazwano endonukleazą restrykcyjną.
(ii) Pierwszą endonukleazę restrykcyjną Hind II wyizolowali Smith Wilcox i Kelley (1968). Odkryli, że zawsze przecina cząsteczki DNA w określonym miejscu, rozpoznając określoną sekwencję sześciu par zasad, znaną jako sekwencja rozpoznawania.
(iii) Oprócz Hind II wyizolowano obecnie ponad 900 enzymów restrykcyjnych z ponad 230 szczepów bakterii, z których każdy rozpoznaje różne sekwencje rozpoznawane.
(iv) Nazewnictwo enzymów restrykcyjnych
(a) Pierwsza litera pochodzi od nazwy rodzaju, a kolejne dwie litery od nazwy gatunku komórki prokariotycznej, z której ekstrahowane są enzymy.
(b) Cyfry rzymskie po nazwie pokazują kolejność, w jakiej enzymy zostały wyizolowane ze szczepu bakteryjnego.
Na przykład Eco RI pochodzi z Escherichia coli RY13, a Eco RII pochodzi z E. coli R 245 itd.
(v) Enzymy restrykcyjne należą do klasy enzymów zwanych Nukleazy.
Nukleazy są dwojakiego rodzaju:
Egzonukleazy Usuwają nukleotydy z końców.
Endonukleazy Tną w określonych pozycjach DNA.
(a) Każda endonukleaza restrykcyjna rozpoznaje specyficzny palindromowa sekwencja nukleotydówsw DNA.
(b) Palindrom w DNA jest. sekwencja par zasad, która czyta tak samo na dwóch niciach, gdy orientacja odczytu jest taka sama.
Na przykład, następujące sekwencje czytają to samo na dwóch niciach w kierunku 5′ –> 3′, jak również w kierunku 3′–> 5′.
5′ — GAATTC — 3′
3′ — CTTAAG — 5′
(vi) Mechanizm działania enzymów restrykcyjnych
(a) Enzymy restrykcyjne odcinają nić DNA nieco od centrum miejsc palindromu, ale między tymi samymi dwiema zasadami na przeciwległych niciach.
(b) Pozostawia to na końcach pojedyncze nitki.
(c) Na każdej nitce znajdują się zwisające odcinki zwane lepkimi końcami, jak pokazano na powyższym rysunku. Są one tak nazwane, ponieważ tworzą wiązania wodorowe z ich komplementarnymi odpowiednikami cięcia.
(d) Lepkość końców ułatwia działanie enzymu ligazy DNA.
(e) Endonukleazy restrykcyjne są wykorzystywane w inżynierii genetycznej do tworzenia rekombinowanych cząsteczek DNA, które składają się z DNA z różnych źródeł/genomów.
(f) Te lepkie końce są komplementarne do siebie, gdy są cięte przez ten sam enzym restrykcyjny, dlatego można je łączyć (koniec do końca) przy użyciu ligaz DNA.

7. Separacja i izolacja fragmentów DNA
(i) Cięcie DNA przez endonukleazy restrykcyjne daje fragmenty DNA.
(ii) Technika, która oddziela fragmenty DNA na podstawie ich wielkości nazywa się
elektroforeza żelowa.
(iii) Fragmenty DNA są cząsteczkami naładowanymi ujemnie. Można je rozdzielić, zmuszając je do poruszania się w kierunku anody pod wpływem pola elektrycznego przez ośrodek/matrycę.
(iv) Najczęściej stosowanym podłożem jest agaroza, naturalny polimer wyekstrahowany z wodorostów morskich.
(v) Fragmenty DNA rozdzielają się (rozkładają) zgodnie z ich wielkością dzięki efektowi przesiewania zapewnianemu przez żel agarozowy. Im mniejszy rozmiar fragmentu, tym dalej się porusza.
(vi) Oddzielone fragmenty DNA można uwidocznić dopiero po wybarwieniu DNA związkiem znanym jako bromek etydyny, a następnie ekspozycji na promieniowanie UV.
(vii) Fragmenty DNA mogą być widoczne jako jasne, pomarańczowe prążki. Te oddzielone pasma są wycinane z żelu agarozowego i ekstrahowane z kawałka żelu. To się nazywa elucja.
(viii) Oczyszczone fragmenty DNA można wykorzystać do konstruowania rekombinowanego DNA przez połączenie ich z wektorami do klonowania.

8. Wektory klonujące to cząsteczki DNA, które mogą przenosić obcy segment DNA do komórki gospodarza.
(i) Wektory stosowane w technologii rekombinacji DNA mogą być:
(a) Plazmidy Autonomicznie replikujące koliste pozachromosomalne DNA.
(b) Bakteriofagi Wirusy infekujące bakterie.
(c) Kosmidy Wektory hybrydowe pochodzące z plazmidów zawierających miejsce cos X
(ii) Numer kopii można zdefiniować jako liczbę kopii wektorów obecnych w komórce.
(iii) Bakteriofagi mają dużą liczbę na komórkę, więc ich liczba kopii jest również wysoka w genomie.
(iv) Plazmidy mieć tylko jedną lub dwie kopie na komórkę.
(v) Liczba kopii może wynosić od 1-100 lub więcej niż 100 kopii na komórkę.
(vi) Jeśli obcy fragment DNA jest połączony z DNA bakteriofaga lub plazmidu, jego liczbę można pomnożyć równą liczbie kopii plazmidu lub bakteriofaga.
(vii) Funkcje wymagane do ułatwienia klonowania do Vector
(a) Początek replikacji (Ori) (b) Marker selekcyjny
(c) Miejsca klonowania (d) Wektory do klonowania genów u roślin i zwierząt.
(a) Pochodzenie replikacji (Ori) to sekwencja, od której rozpoczyna się replikacja.

  • Dowolny fragment DNA po połączeniu z tą sekwencją może zostać zreplikowany w komórkach gospodarza.
  • Sekwencja odpowiada również za kontrolowanie liczby kopii połączonego DNA.

(b) Znacznik do wyboru pomaga w identyfikacji i eliminacji nietransformantów oraz selektywnym umożliwianiu wzrostu transformantów.

  • Transformacja to proces, w którym fragment DNA jest wprowadzany do bakterii gospodarza.
  • Geny kodujące oporność na antybiotyki, takie jak ampicylina, chloramfenikol, tetracyklina lub kanamycyna, itp., są przydatnymi markerami selekcyjnymi dla coli.


Wektor do klonowania E.coli pBR322 z miejscami restrykcyjnymi (Hind III, Eco R1
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori i geny oporności na antybiotyki (amp R i tet R ).
kody rop dla białek zaangażowanych w replikację plazmidu.

  • Podwiązanie obcego DNA przeprowadza się w miejscu restrykcyjnym obecnym w jednym z dwóch genów oporności na antybiotyki. Przykładem jest ligacja obcego DNA w miejscu BamHI genu oporności na tetracyklinę w wektorze pBR322.
    –>>Zrekombinowane plazmidy stracą oporność na tetracyklinę z powodu wstawienia obcego DNA. Jednak nadal można go wyselekcjonować spośród nierekombinowanych przez wysianie transformantów na pożywce zawierającej ampicylinę.
    –>> Transformanty rosnące na pożywce zawierającej ampicylinę przenosi się następnie na pożywkę zawierającą tetracyklinę.
    –>>Rekombinanty będą rosły na podłożu zawierającym ampicylinę, ale nie na podłożu zawierającym tetracyklinę.
    –>>Nierekombinanty będą rosły na pożywce zawierającej oba antybiotyki.
    W tym przykładzie jeden gen oporności na antybiotyki pomaga w selekcji transformantów, podczas gdy drugi gen oporności na antybiotyki zostaje „inaktywowany z powodu wstawienia” obcego DNA i pomaga w selekcji rekombinantów.
  • Wybór rekombinantów ze względu na inaktywację antybiotyków jest to uciążliwa procedura, dlatego opracowano alternatywne markery selekcyjne, które odróżniają rekombinanty od nierekombinantów na podstawie ich zdolności do wytwarzania koloru w obecności chromogennego substratu.

–>> W tej metodzie zrekombinowany DNA jest wstawiany do sekwencji kodującej enzymu J3-galaktozydazy.
–>> Prowadzi to do inaktywacji enzymu P-galaktozydazy (inaktywacja insercyjna).
–>> Kolonie bakteryjne, których plazmidy nie mają wstawki, dają niebieski kolor, ale inne nie dają żadnego koloru, gdy rosną na chromogennym podłożu.
(c) Miejsca klonowania są wymagane do połączenia obcego DNA z wektorem.

  • Wektor wymaga bardzo niewielu lub pojedynczych miejsc rozpoznawania dla powszechnie stosowanych enzymów restrykcyjnych.
  • Obecność więcej niż jednego miejsca rozpoznawania w wektorze będzie generować kilka fragmentów prowadzących do komplikacji w klonowaniu genów.

(d) Wektory do klonowania genów roślin i zwierząt jest wiele, które są wykorzystywane do klonowania genów roślin i zwierząt.
W roślinach jako wektor do klonowania stosuje się plazmid indukujący nowotwór (Ti) Agrobacterium tumefaciens.
–>>Agrobacterium tumefaciens jest patogenem kilku roślin dwuliściennych.
–>> Dostarcza fragment DNA znany jako T-DNA do plazmidu Ti, który przekształca normalne komórki roślinne w komórki nowotworowe w celu wytworzenia substancji chemicznych wymaganych przez patogeny. normalne komórki w komórki rakowe.

9. Właściwy organizm gospodarza (do transformacji z rekombinowanym DNA) jest wymagane, ponieważ DNA jako cząsteczka hydrofilowa nie może przejść przez błony komórkowe,
Dlatego bakterie powinny być zdolne do przyjmowania cząsteczek DNA,
(i) Kompetencje to zdolność komórki do przyjmowania obcego DNA.
(ii) Sposoby uczynienia komórki kompetentną są następujące.
(a) Metoda chemiczna W tej metodzie komórkę traktuje się określonym stężeniem dwuwartościowego kationu, takiego jak wapń, w celu zwiększenia rozmiaru porów w ścianie komórkowej.
Komórki są następnie inkubowane z rekombinowanym DNA na lodzie, a następnie umieszczane
je krótko w 42°C, a następnie włóż z powrotem do lodu. Nazywa się to obróbką szoku cieplnego. Umożliwia to bakteriom przyswajanie rekombinowanego DNA.
(b) Metody fizyczne W tej metodzie zrekombinowany DNA jest bezpośrednio wstrzykiwany do jądra komórki zwierzęcej metodą mikroiniekcji.
W roślinach komórki są bombardowane mikrocząstkami złota o dużej prędkości lub
wolfram pokryty DNA nazywany jako biolistyka lub metoda pistoletu genowego.
(c) Rozbrojone wektory patogenów gdy pozwoli się na zainfekowanie komórki, przenieś zrekombinowany DNA do gospodarza.

Pytania egzaminacyjne z poprzednich lat

1 Mark Pytania
1. Dlaczego obce DNA nie może stać się częścią chromosomu na całej jego długości i normalnie się replikować?
[Wszystkie Indie 2014]
Odp.Aby stać się częścią chromosomu, wymagana jest integracja obcego DNA. Ponieważ sam DNA nie może się rozmnażać i replikować, ale raczej wymaga określonej sekwencji do zainicjowania replikacji zwanej początkiem replikacji. Dlatego obce DNA musi być połączone z DNA gospodarza za pomocą enzymów i połączone z Ori, aby mogło być częścią chromosomu i normalnie się replikować, tworząc swoje kopie.

2. Wymień typ komórek gospodarza odpowiednich dla broni genowej do wprowadzenia obcego DNA. [Delhi 2014]
Odp. Komórkami gospodarza odpowiednimi dla pistoletów genowych do wprowadzenia obcego DNA są komórki roślinne.

3. Napisz dwa składniki pierwszej sztucznej rekombinowanej cząsteczki DNA skonstruowanej przez Cohena i Boyera. [Zagraniczny 2014]
Odp.Dwa składniki pierwszej sztucznej rekombinowanej cząsteczki DNA skonstruowanej przez Gohena i Boyera to:
(i) gen oporności na antybiotyki
(ii) plazmid Salmonella typhimurium

4. Nazwij komórki gospodarza, do których stosuje się technikę mikroiniekcji w celu wprowadzenia obcego DNA. [Zagraniczny 2014]
Odp. Technika mikroiniekcji w celu wprowadzenia obcego DNA jest zwykle przeprowadzana w komórce zwierzęcej, czyli bezpośrednio do jądra.

5. Wymień materiał używany jako matryca w elektroforezie żelowej i wymień jego rolę. [Wszystkie Indie 2014C]
Odp. Materiałem używanym jako matryca w elektroforezie żelowej jest agaroza.
Ten żel agarozowy działa jak sito do oddzielania fragmentów DNA w zależności od ich wielkości.

6. Napisz dowolne cztery sposoby wprowadzenia żądanego segmentu DNA do komórki bakteryjnej w eksperymentach technologii rekombinacji. [Wszystkie Indie 2013]
Odp. Sposoby wprowadzenia pożądanego DNA do komórki bakteryjnej to:
(i) mikroiniekcja (ii) rozbrojone wektory patogenów
(iii) porcja przez dwuwartościowy kation, taki jak wapń
(iv) broń bidlistyczna lub genowa

7. Podaj, co się stanie, gdy obcy gen zostanie zligowany w miejscu Sal I plazmidu pBR322. [Delhi 2013c]
Odp. Jeśli obcy gen zostanie zligowany w miejscu Sal I genu oporności na tetracyklinę w wektorze pBR322, zrekombinowany plazmid utraci oporność na tetracyklinę.

8. Wymienić zastosowania wektora klonującego w biotechnologii ? [Delhi 2011]
Odp. Zastosowania wektora klonującego w biotechnologii.
(i) Pomaga w łączeniu obcego/obcego DNA z DNA gospodarza.
(ii) Pomoc w selekcji rekombinantów erf od nierekombinantów.

9. Biotechnologowie odnoszą się do Agrobacterium tumefaciens jako naturalnego inżyniera genetycznego roślin. Podaj powody, aby poprzeć oświadczenie.
[ HOTELE Wszystkie Indie 2011]
Odp. Agrobacterium tumefacieps jest patogenem kilku roślin dwuliściennych. Jest używany jako naturalny inżynier genetyczny, ponieważ jest w stanie dostarczyć kawałek swojego DNA (nazywany T-DNA) w celu przekształcenia normalnych komórek roślinnych w komórki nowotworowe i skierowania komórek nowotworowych do syntezy chemikaliów wymaganych przez patogen.

10. Dlaczego ważne jest posiadanie markera selekcyjnego w wektorze do klonowania? [Wszystkie Indie 2011]
Odp.Marker selekcyjny w wektorze do klonowania pomaga w identyfikacji i selekcji rekombinantów oraz eliminacji nierekombinantów.

11. Dlaczego podczas elektroforezy żelowej fragmenty DNA przemieszczają się w kierunku anody? [gorące Delhi 2011c]
Odp. Fragmenty DNA są cząsteczkami naładowanymi ujemnie, a zatem poruszają się w kierunku anody podczas elektroforezy żelowej.

12. W roku 1963 wyizolowano dwa enzymy odpowiedzialne za ograniczenie wzrostu bakteriofaga w E. coli. Jak działały enzymy ograniczające wzrost bakteriofaga? [Wszystkie Indie 2011c]
Odp.Dwa enzymy odpowiedzialne za ograniczenie wzrostu bakteriofaga w coli to: Egzonukleazy Dodaje grupę metylową do DNA. Endonukleazy Przetnij DNA w określonych punktach.

13. Czym różni się działanie egzonukleazy od endonukleazy.
[Wszystkie Indie 2010]
Odp.Egzonukleaza usuwa nukleotydy z końców DNA, podczas gdy endonukleaza tnie DNA w określonych pozycjach.

14. Wspomnij o roli nożyczek molekularnych w technologii rekombinacji DNA. [Wszystkie Indie 2009]
Odp. Nożyczki molekularne lub enzymy restrykcyjne tną DNA w określonym miejscu, umożliwiając w ten sposób ekstrakcję pożądanego genu i polubienie go z DNA gospodarza.

15. Wymień technikę stosowaną do rozdzielania fragmentów DNA w laboratorium. [Delhi 2008]
Odp. Elektroforeza żelowa służy do oddzielania fragmentów DNA w laboratorium.

16. Jaka jest rola bromku etydyny podczas elektroforezy fragmentów DNA w żelu agarozowym? [Wszystkie Indie 2008C]
Odp. Oddzielone fragmenty DNA podczas elektroforezy w żelu agarozowym są wizualizowane po wybarwieniu DNA bromkiem etydyny w świetle UV. To barwienie nadaje DNA jasnopomarańczowy kolor.
2 pytania dotyczące znaków
17. Jak działa nukleaza restrykcyjna? Wyjaśniać. [Wszystkie Indie 2014]
Odp. Nukleazy restrykcyjne działają poprzez sprawdzanie długości sekwencji DNA, a następnie wiązanie się z określonymi sekwencjami rozpoznawanymi i przecinanie nici na szkieletach fosforanu cukru.
Te nukleazy są dwojakiego rodzaju w zależności od sposobu ich działania.
(i) Egzonukleazy restrykcyjne wyciąć sekwencje na końcowych końcach DNA.
(ii) Endonukleazy restrykcyjne przeciąć między dwiema zasadami sekwencji rozpoznawczej.

18.Napisz rolę Ori i miejsca restrykcyjnego w wektorze klonującym pBR322.
[Delhi 2014]
lub
W jaki sposób Ori i miejsca klonowania ułatwiają klonowanie do wektora?
[Wszystkie Indie 2008C]
Odp.Ori to sekwencja DNA, od której zaczyna się replikacja. Każdy fragment DNA, który musi się replikować w komórce gospodarza, musi być z nim połączony.
Miejsca klonowania odnoszą się do miejsca/sekwencji DNA, gdzie obcy DNA jest połączony.

19. Wyjaśnij na odpowiednim przykładzie nazwę endonukleazy restrykcyjnej. [Delhi 2014]
Odp. Nazwy endonukleaz restrykcyjnych to:
(i) Pierwsza litera nazwy pochodzi od rodzaju, a kolejne dwie od gatunku komórki prokariotycznej, z której ekstrahowane są enzymy.
(ii) Cyfry rzymskie następujące po nazwie pokazują kolejność, w jakiej enzymy zostały wyizolowane ze szczepu bakteryjnego. Na przykład Eco Rl pochodzi z Escherichia coli RY 13, Hind II z Haemophilus influenzae Rd, itp.

20. Jak powstają lepkie końce na nici DNA? Dlaczego tak się nazywają? [Delhi 2014]
Odp.Lepkie końce DNA powstają w wyniku działania enzymów restrykcyjnych endonukleaz. Enzymy te odcinają nić DNA nieco od centrum sekwencji palindromu pomiędzy tymi samymi dwiema zasadami na obu niciach. Skutkuje to jednoniciowymi rozciągnięciami na obu komplementarnych pasmach na ich końcach.
Te wystające odcinki nazywane są lepkimi końcami, ponieważ tworzą wiązania wodorowe z sekwencjami komplementarnych par zasad.

21. W jaki sposób inaktywacja insercyjna enzymu jest stosowana jako marker selekcyjny do odróżniania rekombinantów od nierekombinowanych?
[Zagraniczny 2014]
Odp. Aktywacja insercyjna enzymu J3-galaktozydazy, tj. poprzez wstawienie pożądanego genu w regionie kodującym enzymu, powoduje inaktywację genu (3-galaktozydazy w rekombinantach. Rekombinanty na transformowanych gospodarzach nie są w stanie wytworzyć żadnego koloru, gdy są hodowane na podłożu chromogennym , działając w ten sposób jako marker selekcyjny do odróżniania rekombinantów od nierekombinowanych.

22. Wyjaśnij palindromową sekwencję nukleotydową za pomocą odpowiedniego przykładu. [Zagraniczny 2014]
Odp.Palindromowa sekwencja nukleotydowa to sekwencja par zasad w DNA, która odczytuje to samo na obu komplementarnych niciach DNA, z tą samą orientacją odczytu.
Na przykład
5′-GAATTC-3′
3′-CTTAAG-5′

23. Dlaczego tak się nazywa nożyczki molekularne? Napisz ich zastosowanie w biotechnologii? [Zagraniczny 2014]
Odp. Nożyczki molekularne są tak nazywane, ponieważ tną DNA w określonych sekwencjach między parami zasad.
Ponieważ nożyce molekularne na enzymach restrykcyjnych tną DNA w pożądanych sekwencjach i generują lepkie końce, które ułatwiają łączenie się z genomem gospodarza lub DNA wektora, odgrywają ważną rolę w inżynierii genetycznej lub biotechnologii. Dzieje się tak dlatego, że za pomocą tych enzymów możemy wyciąć pożądany gen i wprowadzić do wektorów do ekspresji.

24. Dlaczego tworzenie kompetentnych komórek jest niezbędne do eksperymentów biotechnologicznych? Wymień dowolne dwa sposoby, dzięki którym można to osiągnąć.
[Delhi 2014C]
Odp. Ponieważ cząsteczki DNA są hydrofilowe, nie mogą przejść przez błony komórkowe. Aby zrekombinowany DNA mógł zostać włączony do genomu wektora lub gospodarza, konieczne jest wprowadzenie DNA do komórki. Dlatego w eksperymentach biotechnologicznych niezbędne jest uczynienie komórek gospodarza kompetentnymi.
Dwa sposoby, dzięki którym komórki mogą być kompetentne do przyjmowania DNA to:
(i) Działanie chemiczne Poprzez zwiększenie stężenia kationu dwuwartościowego, wapnia, zwiększając tym samym wydajność przenikania DNA przez pory w ścianie komórki.
(ii) Obróbka szokiem cieplnym Inkubacja komórek ze zrekombinowanym DNA na lodzie, a następnie krótkotrwała obróbka cieplna w 42°C i ponowne umieszczenie ich z powrotem na lodzie.

25. Czym różni się funkcjonalnie egzonukleaza od endonukleazy? Podaj przykład dowolnych dwóch endonukleaz innych niż Sal I. [Delhi 2013C]
Odp. Egzonukleazy to enzymy, które rozcinają pary zasad DNA na ich końcowych końcach i działają na pojedynczą nić DNA lub przerwy w dwuniciowym DNA. Podczas gdy endonukleazy tną DNA w dowolnym miejscu poza końcowymi końcami i mogą ciąć jedną nić lub obie nici dwuniciowego DNA, np. Eco Rl i Hind II.

26. Wyjaśnij pracę wykonaną przez Cohena i Boyera, która wniosła ogromny wkład w biotechnologię. [Delhi 2012]
Odp. (i) Stanley Cohen i Herbert Boyer skonstruowali pierwszą sztucznie rekombinowaną cząsteczkę DNA (rDNA).
(ii) Wyizolowali gen oporności na antybiotyki przez wycięcie fragmentu DNA z plazmidu za pomocą enzymu restrykcyjnego i połączyli go z natywnym plazmidem Salmonella typhimurium za pomocą ligazy DNA.

27. (i) Rekombinowany wektor z interesującym genem wstawionym do genu enzymu a-galaktozydazy jest wprowadzany do bakterii’. Wyjaśnij metodę, która pomogłaby w selekcji zrekombinowanych kolonii z nierekombinowanych kolonii.
(ii) Dlaczego ta metoda? (.wyboru określanego jako inaktywacja insercyjna? [GORĄCE Wszystkie Indie 2012]
Odp. (i) Zrekombinowane kolonie można odróżnić od nierekombinowanych kolonii na podstawie ich niezdolności do wytworzenia koloru w obecności chromogennego substratu.
Rekombinanty nie dają żadnego koloru, natomiast nierekombinanty wytwarzają niebieski kolor z chromogennym substratem w podłożu.
(ii) Enzym a-galaktozydaza ulega inaktywacji po wstawieniu zrekombinowanego DNA w obrębie sekwencji kodującej enzymu. Tak więc metoda ta nazywana jest inaktywacją insercyjną.

28. Wyjaśnij powody, dla których obcy fragment DNA musi zostać zintegrowany z określoną sekwencją DNA gospodarza w celu jego sklonowania?
[Wszystkie Indie 2011]
Odp.Replikacja DNA jest inicjowana ze specyficznej sekwencji DNA zwanej początkiem replikacji. W celu namnażania obcego DNA w gospodarzu, musi on zostać zintegrowany z miejscem startu replikacji (ori).

29. Wymień kluczowe narzędzia stosowane w technologii rekombinacji DNA. [Delhi 2011]
Odp.Kluczowymi narzędziami stosowanymi w technologii rekombinacji są enzymy restrykcyjne, polimerazy, ligazy, wektory do klonowania oraz kompetentny organizm lub komórki gospodarza.

30. Wyjaśnij rolę plazmidów Ti w biotechnologii. [Delhi 2011]
Odp.Plazmid Ti z Agrobacterium odpowiada za naturalną transformację komórek roślinnych w nowotwory. Jest więc modyfikowany w niepatogenny wektor, ale nadal jest w stanie dostarczyć DNA. Ten rozbrojony plazmid Agrobacterium jest używany jako wektor do transformacji komórek roślinnych, co potwierdza, że ​​odgrywa ważną rolę w biotechnologii.

31. Jak powstają rekombinowane wektory? Dlaczego do stworzenia jednego zrekombinowanego wektora wymagany jest tylko jeden rodzaj endonukleazy restrykcyjnej? [Zagraniczny 2011]
Odp.Tworzenie zrekombinowanych wektorów Wektorowy DNA tnie się w określonym miejscu restrykcyjnym enzymem restrykcyjnym, tym samym, który został użyty do cięcia pożądanego segmentu DNA. Obcy DNA jest następnie łączony z DNA wektora przy użyciu ligazy enzymatycznej’ w celu utworzenia zrekombinowanego wektora.
Ponieważ enzym restrykcyjny rozpoznaje i tnie DNA w określonej sekwencji
zwany miejscem rozpoznania, ten sam enzym restrykcyjny jest używany do wycinania segmentu DNA zarówno z wektora, jak iz drugiego źródła, sp, aby wytworzyć takie same lepkie końce w obu cząsteczkach DNA, aby ułatwić ich łączenie.

32. Przestudiuj poniższy diagram i odpowiedz na następujące pytania
(i) Dlaczego fragmenty DNA w banku D przesunęły się dalej w porównaniu do tych w grupie C?
(ii) Zidentyfikuj koniec anody na schemacie.
(iii) Jak wizualizowane są te fragmenty DNA? [Zagraniczny 2011]
Odp. (i) W paśmie D, fragmenty DNA są mniejsze niż te w paśmie C. Fragmenty rozdzielają się zgodnie z ich wielkością dzięki efektowi przesiewania zapewnianemu przez żel. Tak więc mniejsze fragmenty oddalają się dalej niż większe.
(ii) B to koniec anody na schemacie.
(iii) Żel zawierający fragmenty DNA wybarwia się bromkiem etydyny i wystawia na działanie promieniowania UV. Widoczne stają się pomarańczowe prążki DNA.

33. Rekombinowany DNA powstaje, gdy lepkie końce DNA wektora i obcego DNA łączą się. Wyjaśnij, jak powstają lepkie końce i łączą się? [Wszystkie Indie 2010]
Odp.Lepkie końce powstają, gdy enzym restrykcyjny odcina nici DNA nieco od centrum sekwencji palindromicznej.
Lepkie końce są połączone przez komplementarny czynnik dwóch zasad nici polinukleotydowych oraz przez działanie enzymu, ligazy DNA.

34. Wyjaśnij działanie endonukleazy restrykcyjnej EcoRI.
[Zagraniczny 2010]
Odp.Endonukleaza restrykcyjna Eco Rl przecina nici DNA nieco od centrum sekwencji palindromicznej, ale między tymi samymi dwiema zasadami na dwóch niciach, tj. G i A.
5′-GAATTC-3′
3′- C T T A A G- 5′
(i) Z tego powodu pojedyncze nitki, zwane lepkimi końcami, zwisają na końcu każdego pasma.
(ii) Ze względu na lepkość łatwo tworzą wiązania wodorowe ze swoimi komplementarnymi odpowiednikami.

35. W jaki sposób fragmenty DNA rozdzielone przez elektroforezę żelową są wizualizowane i rozdzielane do wykorzystania w konstruowaniu rekombinowanego DNA?
[ Zagraniczne 201 Wszystkie Indie 2008]
Odp. Oddzielone fragmenty DNA są barwione bromkiem etydyny.
(i) Pod wpływem promieniowania UV oddzielone fragmenty DNA stają się widoczne jako pomarańczowe prążki.
(ii) Oddzielone prążki DNA są wycinane z żelu agarozowego i DNA jest ekstrahowane z tych kawałków żelu, proces ten nazywa się elucją.

36. (i) Zilustruj sekwencję rozpoznawania Eco RI i powiedz, jak się nazywają takie sekwencje?
(ii) Jak endonukleaza restrykcyjna działa na cząsteczkę DNA?
[Wszystkie Indie 2010 C]
Odp.(/’) Sekwencja rozpoznawania Eco R1
5′- G A A T T C -3′
3′- C T T A A G -3′
Te sekwencje nazywane są palindromowymi sekwencjami nukleotydowymi.
(ii) Endonukleaza restrykcyjna działa na określonej długości DNA i wiąże się z DNA w określonej sekwencji rozpoznawczej. Przecina obie podwójne nici DNA, na szkieletach fosforanu cukru, nieco z dala od centrum miejsc palindromicznych, pomiędzy określoną sekwencją lub punktami.

37. Nazwij organizm źródłowy, z którego wyizolowano plazmid Ti. Wyjaśnij zastosowanie tego plazmidu w biotechnologii. [Zagraniczny 2009]
Ans. Plazmid Ti jest izolowany z bakterii Agrobacterium tumefaciens.
Plazmid Ti z Agrobacterium odpowiada za naturalną transformację komórek roślinnych w nowotwory. Jest więc modyfikowany w niepatogenny wektor, ale nadal jest w stanie dostarczyć DNA. Ten rozbrojony plazmid Agrobacterium jest używany jako wektor do transformacji komórek roślinnych, co potwierdza, że ​​odgrywa ważną rolę w biotechnologii.

38. Wymień naturalne źródło agarozy. Wymień jedną rolę agarozy w biotechnologii. [Delhi 2009c]
Odp.Naturalnym źródłem agarozy są wodorosty morskie. Rola agarozy w biotechnologii
(i) Służy do opracowania matrycy do elektroforezy żelowej.
(ii) Pomaga w rozdzielaniu fragmentów na podstawie ich wielkości.

39. Przestudiuj łączenie fragmentów DNA pokazane poniżej:

Wektor do klonowania E.coli pBR322 z miejscami restrykcyjnymi (Hind III, Eco R1
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori i geny oporności na antybiotyki (amp R i tet R ).
kody rop dla białek zaangażowanych w replikację plazmidu.

  • Nazwij DNA A i DNA B.
  • Nazwij enzym restrykcyjny, który rozpoznaje ten palindrom.

Nazwij enzym, który może łączyć te dwa fragmenty DNA.
[Delhi 2008]
Odp. (i) – Wektor/plazmid DNA
B – Obcy DNA
(ii) Eco Rl
(iii) ligaza DNA40. Poniżej zilustrowano łączenie fragmentów DNA.

(i) Imię A i B.
(ii) Uzupełnij palindrom, który jest uznawany przez Eco RI.
(iii) Nazwij enzym, który może łączyć dwa fragmenty DNA.
[Zagraniczny 2008]
Odp.(i) A – Wektor DNA, B-Obcy DNA
(ii) 5′-GAATTC-3′
3′- CTTAAG-5′
(iii) ligaza DNA
Pytania o 3 znaki

41. Wymień i opisz technikę, która pomaga w oddzieleniu fragmentów DNA powstałych przy użyciu endonukleazy restrykcyjnej. [Wszystkie Indie 2014]
Odp. Fragmenty DNA utworzone przy użyciu endonukleaz restrykcyjnych rozdziela się metodą elektroforezy żelowej.
(i) Fragmenty DNA są cząsteczkami naładowanymi ujemnie. W ten sposób poruszają się w kierunku anody pod wpływem pola elektrycznego przez ośrodek.
(ii) Fragmenty DNA rozdzielają się w zależności od ich wielkości ze względu na efekt przesiewania żelu agarozowego.
(iii) Oddzielone fragmenty DNA można oglądać przez barwienie DNA bromkiem etydyny, a następnie ekspozycję na promieniowanie UV.
(iv) Oddzielone prążki DNA wycina się i ekstrahuje z kawałka żelu. Nazywa się to elucją.

42. Narysuj schematyczny diagram wektora kolkolonowego pBR322 i zaznacz w nim co następuje.

  • lub ja
  • rop
  • gen oporności na ampicylinę
  • gen oporności na tetracyklinę
  • miejsce ograniczenia Bam HI
  • miejsce ograniczenia EcoRI

(i) Narysuj schematyczne diagramy segmentów wektora i obcego DNA z sekwencją nukleotydów rozpoznaną przez Eco
(ii) Narysuj segment wektora DNA i obce segmenty DNA po działaniu EcoRI i oznacz wytworzone lepkie końce. [Delhi 2014C]
lub
Narysuj schematyczny szkic plazmidu pBR322 i oznacz w nim:

  • Dowolne dwie witryny z ograniczeniami.
  • Ori i rop
  • Gen oporności na antybiotyki. [Delhi 2012].

Odp. coli wektor klonujący pBR322.
Wektor do klonowania E.coli pBR322 z miejscami restrykcyjnymi (Hind III, Eco R1
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori i geny oporności na antybiotyki (amp R i tet R ).
kody rop dla białek zaangażowanych w replikację plazmidu.
lub
(a) Enzymy restrykcyjne odcinają nić DNA nieco od centrum miejsc palindromu, ale między tymi samymi dwiema zasadami na przeciwległych niciach.
(b) Pozostawia to na końcach pojedyncze nitki.
(c) Na każdej nitce znajdują się zwisające odcinki zwane lepkimi końcami, jak pokazano na powyższym rysunku. Są one tak nazwane, ponieważ tworzą wiązania wodorowe z ich komplementarnymi odpowiednikami cięcia.
(d) Lepkość końców ułatwia działanie enzymu ligazy DNA.
(e) Endonukleazy restrykcyjne są wykorzystywane w inżynierii genetycznej do tworzenia rekombinowanych cząsteczek DNA, które składają się z DNA z różnych źródeł/genomów.
(f) Te lepkie końce są komplementarne do siebie, gdy są cięte przez ten sam enzym restrykcyjny, dlatego można je łączyć (koniec do końca) przy użyciu ligaz DNA.43. Czym są ‘miejsca klonowania’ w wektorze klonującym? Wyjaśnij ich rolę. Nazwij dowolne dwa takie miejsca w pBR322. [Wszystkie Indie 2014C]
Odp.Miejsca klonowania są w rzeczywistości specyficzną, unikalną sekwencją rozpoznawaną przez konkretny enzym restrykcyjny, tak aby połączyć obcy DNA z DNA wektora w celu utworzenia rekombinowanych cząsteczek DNA, (l) Miejsca te są ważne dla łączenia fragmentów DNA wektora i obcego DNA. A także wielokrotne rozpoznawanie sekwencji dla konkretnego enzymu restrykcyjnego w DNA lub wektorze skomplikuje proces klonowania genów.
Dwa miejsca klonowania w pBR322 to BamHI genu oporności na tetracyklinę i PvuI genów oporności ampiciMies.

44. W jaki sposób oddziela się i izoluje fragmenty DNA w celu pobrania odcisku palca DNA? Wyjaśniać. [Zagraniczny 2012]
Odp. Fragmenty DNA utworzone przy użyciu endonukleaz restrykcyjnych rozdziela się metodą elektroforezy żelowej.
(i) Fragmenty DNA są cząsteczkami naładowanymi ujemnie. W ten sposób poruszają się w kierunku anody pod wpływem pola elektrycznego przez ośrodek.
(ii) Fragmenty DNA rozdzielają się w zależności od ich wielkości ze względu na efekt przesiewania żelu agarozowego.
(iii) Oddzielone fragmenty DNA można oglądać przez barwienie DNA bromkiem etydyny, a następnie ekspozycję na promieniowanie UV.
(iv) Oddzielone prążki DNA wycina się i ekstrahuje z kawałka żelu. Nazywa się to elucją

45. (i) Dlaczego tak się nazywa endonukleazy restrykcyjne?
(ii) Co to jest palindromiczna sekwencja nukleotydów? Jak endonukleazy restrykcyjne działają na miejsca palindromiczne, tworząc lepkie końce?
[Delhi 2011C]
Odp. (i) Endonukleazy restrykcyjne są tak nazywane, ponieważ rozpoznają i wykonują cięcie w określonych pozycjach DNA i ograniczają wzrost bakteriofaga.
(ii) (a) Palindrom w DNA to sekwencja par zasad, która odczytuje się tak samo na dwóch niciach DNA, gdy orientacja odczytu jest taka sama.
Na przykład,
5’—GAATTG—3′
3’—CTTAAG—5′
(b) Enzymy restrykcyjne odcinają nić DNA nieco od centrum miejsca palindromu, ale między tymi samymi dwiema zasadami w obu niciach. Tworzy to pojedyncze nici, zwisające na końcach palindromu, zwane lepkimi końcami.

46. ​​W jaki sposób poniższe są wykorzystywane w biotechnologii?

  • Plazmidowe DNA
  • Sekwencja rozpoznawania
  • Elektroforeza żelowa [Wszystkie Indie 2011c]

Odp. (i) Plazmidowy DNA Służy do konstruowania zrekombinowanego DNA poprzez ligację z nim obcego fragmentu DNA. Jest używany jako wektor do klonowania i pomaga w selekcji rekombinantów spośród nierekombinantów.

(ii) Sekwencje rozpoznawania Są to specyficzne sekwencje zasad DNA, w których enzym restrykcyjny tnie DNA. Służą do ekstrakcji pożądanego genu lub fragmentów z cząsteczek DNA.
(iii) Elektroforeza żelowa Jest to technika służąca do rozdzielania fragmentów DNA w zależności od ich wielkości poprzez efekt przesiewania żelu.47. EcoRI służy do wycinania segmentu obcego DNA i wektora DNA w celu utworzenia zrekombinowanego DNA. Pokaż za pomocą schematycznych diagramów.

  • Zestaw palindromowych sekwencji nukleotydowych par zasad, które EcoRI rozpozna w obu segmentach DNA. Zaznacz miejsce, w którym będzie działać EcoRI i przetnij oba segmenty.
  • Lepkie końce utworzone na obu segmentach, gdzie dwa segmenty DNA połączą się później, tworząc zrekombinowany DNA. [Delhi 2010]

Odp. Sekwencja palindromiczna Eco R1 to

5′G AATTC 3′
3’C TTAA G 5′ t
(strzałki wskazują miejsce, w którym przecina pasma.)
(ii) Lepkie końce utworzone na obu segmentach.
(a) Enzymy restrykcyjne odcinają nić DNA nieco od centrum miejsc palindromu, ale między tymi samymi dwiema zasadami na przeciwległych niciach.
(b) Pozostawia to na końcach pojedyncze nitki.
(c) Na każdej nitce znajdują się zwisające odcinki zwane lepkimi końcami, jak pokazano na powyższym rysunku. Są one tak nazwane, ponieważ tworzą wiązania wodorowe z ich komplementarnymi odpowiednikami cięcia.
(d) Lepkość końców ułatwia działanie enzymu ligazy DNA.
(e) Endonukleazy restrykcyjne są wykorzystywane w inżynierii genetycznej do tworzenia rekombinowanych cząsteczek DNA, które składają się z DNA z różnych źródeł/genomów.
(f) Te lepkie końce są komplementarne do siebie, gdy są cięte przez ten sam enzym restrykcyjny, dlatego można je łączyć (koniec do końca) przy użyciu ligaz DNA.48. (i) Nazwij organizm, w którym przedstawiony wektor jest wstawiony, aby uzyskać kopie pożądanego genu.

  • Wymień obszar oznaczony w wektorze odpowiedzialnym za kontrolę liczby kopii wstawionego genu.
  • Nazwij i wyjaśnij rolęwybieralny znacznik w wektorze Pokazano. [Wszystkie Indie 2010]

Odp. (i) Escherichia coli (E. coli)
(ii) Ori w wektorze odpowiada za kontrolę liczby kopii wstawionego genu.
(iii) Jako markery selekcyjne stosuje się geny kodujące oporność na antybiotyki, takie jak tet R oporny na tetracyklinę, amp R oporny na ampicylinę. Jeśli obcy DNA zostanie zligowany w miejscu BamHI genu oporności na tetracyklinę, zrekombinowane plazmidy stracą oporność na tetracyklinę.
Markery selekcyjne pomagają w identyfikacji i eliminacji nietransformantów i selektywnie umożliwiają wzrost transformantów.

49. (i) EcoRI jest endonukleazą restrykcyjną. Jak to się nazywa? Wyjaśniać.
(ii) Napisz sekwencję zasad DNA rozpoznawanych przez enzym. Wymień punkt, w którym enzym wykonuje cięcie w segmencie DNA. [Delhi 2010c]
Odp.(I) Nazwy endonukleaz restrykcyjnych to:
(i) Pierwsza litera nazwy pochodzi od rodzaju, a kolejne dwie od gatunku komórki prokariotycznej, z której ekstrahowane są enzymy.
(ii) Cyfry rzymskie następujące po nazwie pokazują kolejność, w jakiej enzymy zostały wyizolowane ze szczepu bakteryjnego. Na przykład Eco Rl pochodzi z Escherichia coli RY 13, Hind II z Haemophilus influenzae Rd, itp.
(II) Sekwencja rozpoznawana to palindrom, w którym sekwencja pary zasad odczytuje się tak samo na obu niciach DNA, gdy orientacja odczytu jest taka sama,
np. 5′-GAATTC -3′
3′- CTTAAG -5′
Enzym Eco Rl tnie segment DNA przy zasadach G i A na obu niciach tylko wtedy, gdy sekwencja GAATTC

50. (i) Wymień technikę zastosowaną do rozdziału fragmentów DNA.

  • Napisz rodzaj macierzy używanej w tej technice.
  • W jaki sposób odseparowane DNA jest wizualizowane i ekstrahowane do wykorzystania w technologii rekombinacji? [Wszystkie Indie 2010]

Odp. (i) Elektroforeza żelowa.

(ii) Materiałem używanym jako matryca w elektroforezie żelowej jest agaroza.
Ten żel agarozowy działa jak sito do oddzielania fragmentów DNA w zależności od ich wielkości.
(iii) Oddzielone fragmenty DNA są barwione bromkiem etydyny.
(a) Pod wpływem promieniowania UV oddzielone fragmenty DNA stają się widoczne jako pomarańczowe pasma.
(b) Oddzielone prążki DNA są wycinane z żelu agarozowego i DNA jest ekstrahowane z tych kawałków żelu, proces ten nazywa się elucją.

51. (i) Zidentyfikuj rynki do wyboru na diagramie wektora E. coli pokazanym poniżej.
Odp. (i) A– Odporność na ampicylinęD– Odporność na tetracyklinę stosuje się jako markery selekcyjne w wektorze do klonowania E.coli.
(ii) Sekwencja kodująca a-galaktozydazy jest lepszym markerem, ponieważ rekombinanty i nierekombinanty różnicuje się na podstawie ich zdolności do wytwarzania koloru w obecności chromogennego substratu, natomiast selekcja rekombinantów ze względu na inaktywację antybiotyku gen oporności jest żmudnym i czasochłonnym procesem, aby hodować je jednocześnie na dwóch antybiotykach oddzielnie.
(a) Wprowadzenie rDNA do sekwencji kodującej a-galaktozydazy prowadzi do inaktywacji insercyjnej.
(ii) Rekombinanty nie dają koloru niebieskiego, podczas gdy nierekombinanty dają kolor niebieski.

52. Nazwij i wyjaśnij techniki stosowane w separacji i izolacji fragmentów DNA do wykorzystania w technologii rekombinacji DNA.
[Wszystkie Indie 2009]
Odp.Fragmenty DNA utworzone przy użyciu endonukleaz restrykcyjnych rozdziela się metodą elektroforezy żelowej.
(i) Fragmenty DNA są cząsteczkami naładowanymi ujemnie. W ten sposób poruszają się w kierunku anody pod wpływem pola elektrycznego przez ośrodek.
(ii) Fragmenty DNA rozdzielają się w zależności od ich wielkości ze względu na efekt przesiewania żelu agarozowego.
(iii) Oddzielone fragmenty DNA można oglądać przez barwienie DNA bromkiem etydyny, a następnie ekspozycję na promieniowanie UV.
(iv) Oddzielone prążki DNA wycina się i ekstrahuje z kawałka żelu. Nazywa się to elucją.

53. Dlaczego geny kodujące oporność na antybiotyki są uważane za przydatne markery selekcyjne wektora do klonowania coli? Wyjaśnij za pomocą jednego przykładu. [Delhi 2009c]
Odp. Uważa się, że geny kodujące oporność na antybiotyki są przydatne do selekcji
znaczniki, ponieważ normalne £. komórki coli nie są odporne na żaden z tych antybiotyków.
Przykład Obcy DNA liguje się w miejscu BamHI genu oporności na tetracyklinę w wektorze pBR322. Zrekombinowane plazmidy stracą oporność na tetracyklinę z powodu wstawienia obcego DNA, ale nadal mogą być wybrane spośród nierekombinowanych przez wysianie transformantów na pożywce zawierającej ampicylinę.
Transformanty rosnące na pożywce zawierającej ampicylinę przenosi się następnie na pożywkę zawierającą tetracyklinę. Rekombinanty nie będą rosły, podczas gdy nierekombinanty będą rosły na pożywce zawierającej oba antybiotyki. Gen oporności na antybiotyki pomaga zatem w selekcji transformantów.

54. (i) Napisz palindromową sekwencję nukleotydową dla następującego segmentu DNA
5′- GAATTC- 3′

  • Nazwij endonukleazę restrykcyjną, która rozpoznaje tę sekwencję.
  • Jak powstają lepkie końcówki? Wspomnij ich rolę. [Wszystkie Indie 2009]

Odp. (i) Sekwencja palindromiczna dla

5′- GAATTC- 3′
3′- CTTAAG -5′.
(ii) Endonukleaza restrykcyjna EcoRI rozpoznaje powyższą sekwencję palindromową.
(iii) Lepkie końce na DNA powstają w wyniku działania enzymów endonukleaz restrykcyjnych. Enzymy te odcinają nić DNA nieco od centrum sekwencji palindromu pomiędzy tymi samymi dwiema zasadami na obu niciach. Skutkuje to jednoniciowymi rozciągnięciami na obu komplementarnych pasmach na ich końcach.
Te wystające odcinki nazywane są lepkimi końcami, ponieważ tworzą wiązania wodorowe z sekwencjami komplementarnych par zasad.
Rola lepkich końcówek Te lepkie końce tworzą wiązania wodorowe z ich komplementarnymi ciętymi odpowiednikami. Ta lepkość końców ułatwia działanie enzymu ligazy DNA.

55. (i) Czym są nożyczki molekularne?
Podaj jeden przykład.
(ii) Wyjaśnij ich rolę w technologii rekombinacji DNA.
[Delhi 2008 Zagraniczne 2008]
lub
(i) Nazwij kategorię enzymów, które przecinają określone miejsce w cząsteczce DNA. Daj przykład.
(ii) Wyjaśnij, jak działają te enzymy? Wymień ich zastosowanie w inżynierii genetycznej. [Wszystkie Indie 2008C]
Odp. (i) Nożyczki molekularne są endonukleazami restrykcyjnymi, ponieważ przecinają segmenty DNA w określonych miejscach lub w określonej sekwencji, np. Eco Rl.
(ii) Enzymy restrykcyjne odcinają nić DNA nieco od centrum miejsc palindromicznych, ale między tymi samymi dwiema zasadami na przeciwległych niciach. Pozostawia to pojedyncze splecione części na końcach ze zwisającymi odcinkami zwanymi lepkimi końcami na każdym pasmie. Te końce tworzą wiązania wodorowe z ich komplementarnymi ciętymi odpowiednikami. Ta lepkość końców ułatwia działanie enzymu ligazy DNA.

56. Dlaczego Agrobacterium tumefaciens jest dobrym wektorem do klonowania? Wyjaśniać.
[Wszystkie Indie 2008]
Odp. Agrobacterium tumefaciens to bakteria glebowa, która powoduje choroby wielu roślin dwuliściennych. Jest to naturalny wektor, ponieważ jest w stanie dostarczyć fragment DNA znany jako T-DNA, aby przekształcić normalne komórki w komórki nowotworowe i skierować te komórki nowotworowe do produkcji substancji chemicznych wymaganych przez patogen.
Plazmid indukujący nowotwór (Ti) A. tumefaciens został teraz zmodyfikowany w wektor do klonowania, który nie jest już bardziej patogenny dla roślin, ale nadal dostarcza gen będący przedmiotem zainteresowania, który zostaje włączony do genomu rośliny.

57. Wyjaśnij znaczenie
(i) ori (ii) amp R i (iii) roop w wektorze E.coli pokazanym poniżej.
[Wszystkie Indie 2008]
Odp.(i) Ori to sekwencja DNA, z której rozpoczyna się replikacja, a każdy fragment DNA, po połączeniu z tą sekwencją, może być replikowany w komórkach gospodarza.
Odpowiada również za kontrolowanie liczby kopii połączonego DNA.
(ii) ampR jest genem oporności na antybiotyki, w którym ligację obcego DNA prowadzi się w miejscu restrykcyjnym.
(iii) kody rop dla białek biorących udział w replikacji plazmidu.

58. Wektor jest skonstruowany z trzema cechami, które ułatwiają jego klonowanie w komórce gospodarza. Wymień trzy cechy i wyjaśnij każdą z nich.
[Zagraniczny 2008]
Odp. Funkcje ułatwiające klonowanie wektora to:
(i) Pochodzenie replikacji (Lub ja)

  • To jest sekwencja DNA, od której zaczyna się replikacja.
  • Każdy połączony z nim fragment obcego/obcego DNA jest replikowany w komórce gospodarza. Decyduje również o liczbie kopii połączonego[ DNA.
    (ii) Wybieralny znacznik jest genem markerowym, który pomaga w selekcji komórek gospodarza będących transformantami/rekombinantami spośród komórek nierekombinowanych.
    Na przykład geny oporności na ampicylinę i tetracyklinę w £. coli.
    (iii) Miejsce klonowania to unikatowe miejsce rozpoznawane w wektorze do łączenia obcego DNA. Obecność określonego miejsca klonowania/rozpoznawania pomaga poszczególnym enzymom restrykcyjnym w cięciu DNA wektora. Powszechnie preferowane jest pojedyncze miejsce rozpoznawania.
    (iv) Mały rozmiar wektora Mały rozmiar ułatwia wprowadzenie DNA do gospodarza.

59. Dlaczego komórka musi być kompetentna do przyjmowania DNA? Wyjaśnij kroki, dzięki którym komórki bakteryjne stały się kompetentne do przyjmowania plazmidu/rDNA. [Delhi 2008C]

Odp. DNA będący hydrofilową cząsteczką nie może przejść przez błonę komórkową. W ten sposób komórka bakteryjna staje się kompetentna do przyjęcia cząsteczki DNA. Kompetencja to zatem zdolność komórki do przyjmowania obcego DNA.
Aby komórka bakteryjna była kompetentna, stosuje się następujące metody:
bakterie powinny być zdolne do przyjmowania cząsteczek DNA,
(i) Kompetencje to zdolność komórki do przyjmowania obcego DNA.
(ii) Sposoby uczynienia komórki kompetentną są następujące.
(a) Metoda chemiczna W tej metodzie komórkę traktuje się określonym stężeniem dwuwartościowego kationu, takiego jak wapń, w celu zwiększenia rozmiaru porów w ścianie komórkowej.

  • Komórki są następnie inkubowane z rekombinowanym DNA na lodzie, a następnie umieszczane
  • je krótko w 42°C, a następnie włóż z powrotem do lodu. Nazywa się to obróbką szoku cieplnego.
    • Umożliwia to bakteriom przyswajanie rekombinowanego DNA.
    (b) Metody fizyczne W tej metodzie zrekombinowany DNA jest bezpośrednio wstrzykiwany do jądra komórki zwierzęcej metodą mikroiniekcji.
    • W roślinach komórki są bombardowane mikrocząstkami złota o dużej prędkości lub
    wolfram pokryty DNA nazywany jako biolistyka lub metoda pistoletu genowego.
    (c) Rozbrojone wektory patogenów gdy pozwoli się na zainfekowanie komórki, przenieś zrekombinowany DNA do gospodarza.

60. Przeczytaj następującą sekwencję zasad określonej nici DNA i odpowiedz na następujące pytania:

  • Co nazywa się sekwencją palindromiczną w DNA?
  • Napisz palindromową sekwencję nukleotydową pokazaną w podanej nici DNA i wspomnij o enzymie, który rozpozna taką sekwencję.
  • Określ znaczenie enzymów, które identyfikują palindromowe sekwencje nukleotydowe. [Wszystkie Indie 2008C]

Odp. (i) Sekwencja palindromiczna w DNA to sekwencje zasad, które czytają się tak samo, zarówno w kierunku do przodu, jak i do tyłu.
(ii) Sekwencja palindromiczna w DNA 5′-GAATTC-3′
3 – CTTAAG- 5′
Sekwencja odczytuje to samo na dwóch niciach w kierunku 5′-> 3′. To samo dotyczy odczytu w kierunku 3′->5′. Endonukleaza restrykcyjna rozpoznaje taką sekwencję.
DNA będący hydrofilową cząsteczką nie może przejść przez błonę komórkową. W ten sposób komórka bakteryjna staje się kompetentna do przyjęcia cząsteczki DNA. Kompetencja to zatem zdolność komórki do przyjmowania obcego DNA.
Aby komórka bakteryjna była kompetentna, stosuje się następujące metody:
bakterie powinny być zdolne do przyjmowania cząsteczek DNA,
(i) Kompetencje to zdolność komórki do przyjmowania obcego DNA.
(ii) Sposoby uczynienia komórki kompetentną są następujące.
(a) Metoda chemiczna W tej metodzie komórkę traktuje się określonym stężeniem dwuwartościowego kationu, takiego jak wapń, w celu zwiększenia rozmiaru porów w ścianie komórkowej.

je krótko w 42°C, a następnie włóż z powrotem do lodu. Nazywa się to obróbką szoku cieplnego.
• Umożliwia to bakteriom przyswajanie rekombinowanego DNA.
(b) Metody fizyczne W tej metodzie zrekombinowany DNA jest bezpośrednio wstrzykiwany do jądra komórki zwierzęcej metodą mikroiniekcji.
• W roślinach komórki są bombardowane mikrocząstkami złota o dużej prędkości lub
wolfram pokryty DNA nazywany jako biolistyka lub metoda pistoletu genowego.
(c) Rozbrojone wektory patogenów gdy pozwoli się na zainfekowanie komórki, przenieś zrekombinowany DNA do gospodarza.
Znaczenie endonukleaz restrykcyjnych Wykorzystywane są w inżynierii genetycznej do tworzenia rekombinowanych cząsteczek DNA,
które składają się z DNA z różnych źródeł/genomów i umożliwiają wyizolowanie pożądanego fragmentu genu i połączenie go z gospodarzem na wektorowym DNA ze względu na wytworzone lepkie końce.
5 pytań dotyczących znaków

61. (i) Opisz cechy, które musi posiadać wektor klonujący.
(ii) Dlaczego DNA nie może przejść przez błonę komórkową? Wyjaśniać. W jaki sposób komórka bakteryjna jest kompetentna do pobierania zrekombinowanego DNA z pożywki? [Wszystkie Indie 2011]
Odp.(I) Następujące funkcje są wymagane, aby ułatwić klonowanie do wektora
Funkcje ułatwiające klonowanie wektora to:
(i) Pochodzenie replikacji (Lub ja)

  • To jest sekwencja DNA, od której zaczyna się replikacja.
  • Każdy połączony z nim fragment obcego/obcego DNA jest replikowany w komórce gospodarza. Decyduje również o liczbie kopii połączonego[ DNA.

(ii) Wybieralny znacznik jest genem markerowym, który pomaga w selekcji komórek gospodarza będących transformantami/rekombinantami spośród komórek nierekombinowanych.
Na przykład geny oporności na ampicylinę i tetracyklinę w £. coli.
(iii) Miejsce klonowania to unikatowe miejsce rozpoznawane w wektorze do łączenia obcego DNA. Obecność określonego miejsca klonowania/rozpoznawania pomaga poszczególnym enzymom restrykcyjnym w cięciu DNA wektora. Powszechnie preferowane jest pojedyncze miejsce rozpoznawania.
(iv) Mały rozmiar wektora Mały rozmiar ułatwia wprowadzenie DNA do gospodarza.
(II) DNA będący hydrofilową cząsteczką nie może przejść przez błonę komórkową. W ten sposób komórka bakteryjna staje się kompetentna do przyjęcia cząsteczki DNA. Kompetencja to zatem zdolność komórki do przyjmowania obcego DNA.
Aby komórka bakteryjna była kompetentna, stosuje się następujące metody:
bakterie powinny być zdolne do przyjmowania cząsteczek DNA,
(i) Kompetencje to zdolność komórki do przyjmowania obcego DNA.
(ii) Sposoby uczynienia komórki kompetentną są następujące.
(a) Metoda chemiczna W tej metodzie komórkę traktuje się określonym stężeniem dwuwartościowego kationu, takiego jak wapń, w celu zwiększenia rozmiaru porów w ścianie komórkowej.

je krótko w 42°C, a następnie włóż z powrotem do lodu. Nazywa się to obróbką szoku cieplnego.
• Umożliwia to bakteriom przyswajanie rekombinowanego DNA.
(b) Metody fizyczne W tej metodzie zrekombinowany DNA jest bezpośrednio wstrzykiwany do jądra komórki zwierzęcej metodą mikroiniekcji.
• W roślinach komórki są bombardowane mikrocząstkami złota o dużej prędkości lub
wolfram pokryty DNA nazywany jako biolistyka lub metoda pistoletu genowego.
(c) Rozbrojone wektory patogenów gdy pozwoli się na zainfekowanie komórki, przenieś zrekombinowany DNA do gospodarza.62. (i) Za pomocą diagramów przedstaw różne etapy tworzenia zrekombinowanego DNA w wyniku działania enzymu restrykcyjnego endonukleazy EcoRI.
(ii) Nazwij technikę stosowaną do rozdzielania fragmentów DNA pociętych endonukleazami restrykcyjnymi. [Wszystkie Indie 2011]
Odp. (i) Tworzenie zrekombinowanego DNA przez działanie enzymu restrykcyjnego endonukleazy Eco R1.
Enzym restrykcyjny tnie obie nici DNA w tym samym miejscu, wytwarzając lepkie końce.
(a) Enzymy restrykcyjne odcinają nić DNA nieco od centrum miejsc palindromu, ale między tymi samymi dwiema zasadami na przeciwległych niciach.
(b) Pozostawia to na końcach pojedyncze nitki.
(c) Na każdej nitce znajdują się zwisające odcinki zwane lepkimi końcami, jak pokazano na powyższym rysunku. Są one tak nazwane, ponieważ tworzą wiązania wodorowe z ich komplementarnymi odpowiednikami cięcia.
(d) Lepkość końców ułatwia działanie enzymu ligazy DNA.
(e) Endonukleazy restrykcyjne są wykorzystywane w inżynierii genetycznej do tworzenia rekombinowanych cząsteczek DNA, które składają się z DNA z różnych źródeł/genomów.
(f) Te lepkie końce są komplementarne do siebie, gdy są cięte przez ten sam enzym restrykcyjny, dlatego można je łączyć (koniec do końca) przy użyciu ligaz DNA.
(ii) Elektroforeza żelowa.

63. (i) Dlaczego biotechnologowie preferują wektory inżynieryjne do przenoszenia pożądanych genów do innego organizmu?(ii) Wyjaśnij, w jaki sposób ori, marker selekcyjny i miejsca klonowania ułatwiają klonowanie do wektora? [Zagraniczny 2009]
Odp. (I) Zaprojektowane wektory są preferowane przez biotechnologów, ponieważ pomagają w łatwym łączeniu obcego DNA i selekcji rekombinantów spośród nierekombinantów.
(II) Cechy ułatwiające klonowanie wektora to:
(i) Pochodzenie replikacji (Lub ja)

  • To jest sekwencja DNA, od której zaczyna się replikacja.
  • Każdy połączony z nim fragment obcego/obcego DNA jest replikowany w komórce gospodarza. Decyduje również o liczbie kopii połączonego[ DNA.

(ii) Wybieralny znacznik jest genem markerowym, który pomaga w selekcji komórek gospodarza będących transformantami/rekombinantami spośród komórek nierekombinowanych.
Na przykład geny oporności na ampicylinę i tetracyklinę w £. coli.
(iii) Miejsce klonowania to unikatowe miejsce rozpoznawane w wektorze do łączenia obcego DNA. Obecność określonego miejsca klonowania/rozpoznawania pomaga poszczególnym enzymom restrykcyjnym w cięciu DNA wektora. Powszechnie preferowane jest pojedyncze miejsce rozpoznawania.
(iv) Mały rozmiar wektora Mały rozmiar ułatwia wprowadzenie DNA do gospodarza.


Jak zsekwencjonowano miejsce restrykcyjne EcoRI? - Biologia

Ograniczenie witryny, lub ograniczenie rozpoznawane miejsca, to specyficzne sekwencje nukleotydów, które są rozpoznawane przez ograniczenie enzymy. Miejsca są na ogół palindromiczne, a szczególne ograniczenie Enzym może ciąć sekwencję pomiędzy dwoma nukleotydami w jego obrębie.
Cały artykuł >>>

A ograniczenie Enzym to enzym, który tnie dwuniciowy lub jednoniciowy DNA w określonych sekwencjach nukleotydowych rozpoznawanych jako ograniczenie witryny. Uważa się, że takie enzymy, znajdujące się w bakteriach i archeonach, mają.
Cały artykuł >>>

Jak mogę dodać Strona do Internet Explorera Ograniczony Witryny Strefa? . Ponieważ mówimy o Ograniczony Witryny strefa, którą prawdopodobnie zechcesz.
Cały artykuł >>>

Znaleziska ograniczenie rozszczepienie endonukleazy witryny w sekwencjach DNA. Obsługuje liniowe i kołowe DNA oraz zapewnia kilka sposobów sortowania i filtrowania danych wyjściowych.
Cały artykuł >>>

CLC bio oferuje szeroką gamę światowej klasy rozwiązań bioinformatycznych: od wysoce zaawansowanej analizy sekwencji. interaktywny ograniczenie Strona analiza .
Cały artykuł >>>

CLC bio oferuje szeroką gamę światowej klasy rozwiązań bioinformatycznych: Od wysoce zaawansowanej analizy sekwencji. Ograniczenie Strona wykrycie. Odwrócić .
Cały artykuł >>>

. strefy w Microsoft Internet Explorer i jak skonfigurować różne poziomy bezpieczeństwa dla sieci witryny które odwiedzasz. . Strona do Ograniczony Witryny strefa, .
Cały artykuł >>>

Wskazuje ograniczenie witryny enzymów Fermentas, które są wrażliwe (rozszczepienie . Nie ma ograniczenie witryny w DNA PhiX174 dla następujących enzymów: .
Cały artykuł >>>

Wskazuje ograniczenie witryny enzymów Fermentas, które są wrażliwe (rozszczepienie . Brak ograniczenie witryny w DNA M13mp18 dla następujących enzymów: .
Cały artykuł >>>

ograniczenie Strona synonimy, ograniczenie Strona antonimy. Informacja o ograniczenie Strona . ograniczenie-Strona wielopostaciowość. Ograniczający. restrykcjonizm .
Cały artykuł >>>

Ograniczony Strona. Ten Strona jest do użytku pracowników Rady Północno-Wschodniej Gruzji, Boy. poufne lub prywatne informacje zawarte w tej sieci Strona. .
Cały artykuł >>>

Ten artykuł zawiera szczegółowe informacje na temat blokowania niechcianych reklam, banerów, wyskakujących okienek, pasożytów, porywaczy i wyszukiwarek, umieszczając je w Ograniczony Strefa
Cały artykuł >>>

Sekwencje zdegenerowane Analizuj ograniczenie mapy sekwencji . Wskaż, w jaki sposób chcesz ograniczenie witryny wystawiany. Mapa ograniczenie witryny .
Cały artykuł >>>

Możesz zobaczyć naszą listę ograniczony witryny Jest bardzo duże. . Dodajmy Strona do Ograniczony Witryny lista. Zwróć uwagę na format wpisu. .
Cały artykuł >>>

Jak surferzy odnajdują drogę w czasie wojny do ograniczony lub ocenzurowane witryny . Obie mają ograniczony darmowe wersje. Te witryny ukryj swoją lokalizację i chroń .
Cały artykuł >>>

Witryny umieszczone w strefie wysokiego bezpieczeństwa będą wtedy ograniczony w dostępie. Jesteś chroniony, jeśli: Strona jest w twoim ograniczony strefa. .
Cały artykuł >>>

Długość ograniczenie uznanie witryny zmienia się: Enzymy EcoRI, SacI i . Różne ograniczenie enzymy mogą mieć takie samo rozpoznanie Strona - takie enzymy.
Cały artykuł >>>


Regulatory sygnalizacji białka G, część B

Patrizia Tosetti , Kathleen Dunlap , w Metody w Enzymologii , 2004

Produkcja retrowirusów zdolnych do replikacji.

5′ Xba miejsce restrykcyjne I (TCT AGA), po którym następuje dodatkowa sekwencja translacji/transkrypcji (CCA CGT TGG CCA GGC GGT AGC TGG GAC GTG CAG CCG ACC ACC) i epitop 3' HA (TAC GAC GTG CCC GAC TAC GCC), po którym następuje stop kodon (TAG) i a hinMiejsce restrykcyjne dIII (AAG CTT) konstruuje się w ramce w cDNA wariantu RGS3 metodą PCR, stosując startery niosące odpowiednie sekwencje. Produkty PCR są następnie trawione i subklonowane w ramce do XbaI/hinmiejsca dill plazmidu adaptacyjnego Cla12 NCO. Interesujące sekwencje są następnie wycinane z plazmidu adaptorowego przez ClaI trawienie i są subklonowane bezkierunkowo do ClaMiejsce I retrowirusowych wariantów RCASBP podgrupy B (oba plazmidy były hojnym darem dr Donny Fekete, Purdue University, West Lafayette, IN). Wszystkie ligacje przeprowadza się przy użyciu zestawu do szybkiego ligacji DNA firmy Boehringer Mannheim (Indianapolis, IN), zgodnie z instrukcjami producenta. Enzymy restrykcyjne pochodzą z New England Biolabs (Beverly, MA). Prawidłowo zorientowane konstrukty są identyfikowane przez PCR i sekwencjonowanie.


Możesz także filtrować enzymy według tego, gdzie lub ile razy przecinają sekwencję. Na przykład możesz filtrować, aby zobaczyć tylko enzymy, które są pojedynczymi lub podwójnymi obcinaczami. Możesz także zobaczyć enzymy, które wycinają gdziekolwiek poza bieżącym wyborem.

Kliknij ponownie ikonę nożyczek, aby zamknąć panel Skróty. Kliknij dwukrotnie miejsce cięcia na mapie sekwencji i zauważ, że panel automatycznie otworzy się, aby pokazać więcej informacji o enzymie.


Bakteryjna autoimmunizacja ze względu na system restrykcji-modyfikacji

Systemy restrykcyjne-modyfikacji (RM) reprezentują minimalny i wszechobecny biologiczny system dyskryminacji siebie/nie-ja u prokariotów [1], który chroni żywiciela przed egzogennym DNA [2]. Mechanizm opiera się na równowadze między metylotransferazą (M) a pokrewną endonukleazą restrykcyjną (R). M oznacza endogenny DNA jako własny, metylując krótkie, specyficzne sekwencje DNA zwane miejscami restrykcyjnymi, podczas gdy R rozpoznaje niemetylowane miejsca restrykcyjne jako niebędące własnym i wprowadza pęknięcie dwuniciowego DNA [3]. Miejsca restrykcji są znacząco niedoreprezentowane w genomach prokariotycznych [4-7], co sugeruje, że mechanizm różnicowania jest niedoskonały i czasami prowadzi do autoimmunizacji z powodu rozszczepienia własnego DNA (samoograniczenia) [8]. Ponadto systemy RM mogą promować rekombinację DNA [9] i przyczyniać się do zmienności genetycznej w populacjach drobnoustrojów, ułatwiając w ten sposób ewolucję adaptacyjną [10]. Jednak rozszczepienie własnego DNA przez systemy RM jako elementy kształtujące genomy prokariotyczne nie zostało bezpośrednio wykryte, a jego przyczyna, częstotliwość i wynik są nieznane. Oceniamy ilościowo samoograniczenie spowodowane przez dwa systemy RM Escherichia coli i stwierdzamy, że zgodnie z poziomami unikania miejsc restrykcyjnych, EcoRI, ale nie EcoRV, rozszczepia własny DNA z mierzalną szybkością. Samoograniczanie jest procesem stochastycznym, który tymczasowo indukuje odpowiedź SOS, po czym następuje naprawa DNA, utrzymująca żywotność komórek. Odkryliśmy, że systemy RM o wyższej skuteczności restrykcji przeciwko infekcjom bakteriofagowym wykazują wyższy wskaźnik samoograniczenia, który można dodatkowo zwiększyć przez stochastyczną nierównowagę między R i M. Nasze wyniki identyfikują szum molekularny w systemach RM jako czynnik kształtujący prokariotyczny genomy.


Częstotliwości witryn z ograniczeniami

Poniższa tabela podsumowuje częstości występowania miejsc endonukleaz restrykcyjnych w powszechnie stosowanych cząsteczkach DNA. Szczegółowe mapy restrykcyjne można znaleźć na sekwencjach i mapach DNA. Miejsca wymienione w tych tabelach zostały zidentyfikowane przez analizę komputerową opublikowanych sekwencji. Chociaż staraliśmy się zapewnić ich dokładność, witryny niekoniecznie zostały potwierdzone eksperymentalnie. Gdy ta sama specyficzność jest prezentowana przez kilka enzymów, miejsce jest wymienione pod nazwą enzymu, który jest dostępny w New England Biolabs. Inne enzymy o tej samej specyficzności są wymienione w tabeli izoschizomerów. Sekwencje rozpoznawania są zapisywane od 5&ostrej do 3&ostrej.

DNASU jest centralnym repozytorium klonów i kolekcji plazmidów, które również mogą być pomocne.

Enzym Sekwencja rozpoznawania Adeno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNN/NNNNNNNNNN
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
WiekI § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
Ahd GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
Alu AG/CT 158 143 27 17 38 28 27 30 34 16 140
Zawsze GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
Apali GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
Apali G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
Dostępność C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
Dostępność G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
Bani G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI OWH(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGGG(5/4) 22 4 1 5 2 5 11 8 2 6
§ GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI knebel(10/8) 63 19 1 0 2 0 3 0 0 0 13
BSEYI CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI OWZ(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI OWH(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BSRI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGTG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
EarI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EkoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI /KAT. 183 181 14 26 38 23 21 23 31 11 148
FauI CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGTG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI CC(12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
Kasi G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG(10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
mgr inż TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
Msi T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
§ C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII KAT./ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
Nie I § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
§ ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/T 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI OWH(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PCII A/CTGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATTGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
Plei GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CWC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI .Name /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/KTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/KTG 24 15 3 1 3 3 3 3 4 2 3
Rsali GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
Swahi ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TakI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
XmaI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI GAC/OWT 3 10 0 1 0 0 5 1 0 1 1

§ Dostępna jest wersja HF tego enzymu.

* W przypadku M13mp18 zostaną wycięte tylko regiony dwuniciowe.
** Dotyczy substratu DNA typu dzikiego Hind III ma 6 miejsc restrykcyjnych w DNA faga lambda typu dzikiego, podczas gdy mutant faga lambda NEB (Lambda DNA, NEB #N3011) ma 7 miejsc Hind III.


Częstotliwości witryn z ograniczeniami

Poniższa tabela podsumowuje częstości występowania miejsc endonukleaz restrykcyjnych w powszechnie stosowanych cząsteczkach DNA. Szczegółowe mapy restrykcyjne można znaleźć na sekwencjach i mapach DNA. Miejsca wymienione w tych tabelach zostały zidentyfikowane przez analizę komputerową opublikowanych sekwencji. Chociaż staraliśmy się zapewnić ich dokładność, witryny niekoniecznie zostały potwierdzone eksperymentalnie. Gdy ta sama specyficzność jest prezentowana przez kilka enzymów, miejsce jest wymienione pod nazwą enzymu, który jest dostępny w New England Biolabs. Inne enzymy o tej samej specyficzności są wymienione w tabeli izoschizomerów. Sekwencje rozpoznawania są zapisywane od 5&ostrej do 3&ostrej.

DNASU jest centralnym repozytorium klonów i kolekcji plazmidów, które również mogą być pomocne.

Enzym Sekwencja rozpoznawania Adeno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNN/NNNNNNNNNN
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
WiekI § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
Alu AG/CT 158 143 27 17 38 28 27 30 34 16 140
Zawsze GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
Apali GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
Apali G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
Dostępność C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
Dostępność G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
Bani G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI OWH(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGGG(5/4) 22 4 1 5 2 5 11 8 2 6
§ GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI knebel(10/8) 63 19 1 0 2 0 3 0 0 0 13
BSEYI CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI OWZ(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI OWH(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BSRI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGTG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
EarI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EkoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI /KAT. 183 181 14 26 38 23 21 23 31 11 148
FauI CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGTG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI CC(12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
Kasi G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG(10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
mgr inż TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
Msi T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
§ C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII KAT./ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
Nie I § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
§ ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/T 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI OWH(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PCII A/CTGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATTGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
Plei GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CWC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI .Name /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/KTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/KTG 24 15 3 1 3 3 3 3 4 2 3
Rsali GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
Swahi ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TakI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
XmaI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI GAC/OWT 3 10 0 1 0 0 5 1 0 1 1

§ Dostępna jest wersja HF tego enzymu.

* W przypadku M13mp18 zostaną wycięte tylko regiony dwuniciowe.
** Dotyczy substratu DNA typu dzikiego Hind III ma 6 miejsc restrykcyjnych w DNA faga lambda typu dzikiego, podczas gdy mutant faga lambda NEB (Lambda DNA, NEB #N3011) ma 7 miejsc Hind III.


Obejrzyj wideo: AP Biology: Restriction Enzyme Digests on Circular Plasmids (Październik 2022).