Informacja

Czy mutacje genów spowodują powstanie białka, które jest krótsze niż białko o pełnej długości?

Czy mutacje genów spowodują powstanie białka, które jest krótsze niż białko o pełnej długości?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Jaki jest związek między delecją lub insercją nukleotydu w sekwencji genu a długością białka zakodowanego ze zmutowanego genu?


Zależy to od charakteru wstawiania lub usuwania.

Wiele mutacji jest punkt mutacje, w których zmienia się jeden nukleotyd:

ATGACTACGCTATTCAGT M T T L F S ATGTCTACGCTATTCAGT M S T L F S

Zauważ, że zmiana czwartego A na T spowodowała zmianę T->S w końcowym białku i nie zmieniła jego długości. Jednak wstawianie/usuwanie jest inne. Zaczynając od tej sekwencji:

ATGTCTATTGACGCTATTCAG M S I D A I Q

Zróbmy wstawienie, A po A na pozycji 7:

ATGTCTAATTGACGCTATTCAG M S N STOP

Zauważ, że mamy teraz kodon stop (TGA). Oznacza to, że białko zostanie okrojone i będzie znacznie mniejsze. Nie zawsze tak jest. Zamiast dodawać A na pozycji 7, dodajmy ją po pozycji 9:

ATGTCTATTAGACGCTATTCA M S I R R Y S

Białko ma mniej więcej taką samą długość, ale po wstawieniu AA są zupełnie inne niż oryginalna wersja:

M S I D A I Q M S I R R Y S

Nazywa się to mutacją przesunięcia ramki. Z biologicznego punktu widzenia mutacje te są szkodliwe, ponieważ zmieniają wszystkie aminokwasy po mutacji, białko często nie jest funkcjonalne i może mieć różne rozmiary (jeśli kodon stop jest teraz w ramce lub poza ramką), a białko może się nawet skończyć się niestabilny i szybko zdegradowany.

Tak więc, aby odpowiedzieć na twoje pytanie dotyczące długości białka, będzie ono wzrastać/zmniejszać o jeden AA za każdym razem, gdy dodawane/usunięte są 3 nukleotydy, ale może się zwiększyć lub zmniejszyć drastycznie jeśli kodon stop zostanie dodany lub usunięty przez mutację przesunięcia ramki.


Silny związek między mechanizmami pseudogenizacji a długością sekwencji genów

Pseudogeny powstają w wyniku rozpadu kopii genów w następstwie duplikacji za pośrednictwem RNA (przetworzone pseudogeny) lub duplikacji za pośrednictwem DNA (nieprzetworzone pseudogeny). Tutaj pokazujemy, że geny kodujące długie białka mają tendencję do wytwarzania większej liczby nieprzetworzonych pseudogenów niż krótkich genów, podczas gdy w przypadku przetworzonych pseudogenów jest odwrotnie. Geny kodujące białka dłuższe niż 3000 pz z 6 razy większym prawdopodobieństwem produkują nieprzetworzone pseudogeny niż te przetworzone.

Recenzenci

Ten artykuł został zrecenzowany przez dr Dana Graura i dr Craiga Nelsona (nominowanego przez dr J Petera Gogartena).


Abstrakcyjny

Lista chorób genetycznych spowodowanych mutacjami wpływającymi na translację mRNA szybko rośnie. Chociaż synteza białek jest podstawowym procesem we wszystkich komórkach, fenotypy chorobowe wykazują zaskakujący stopień niejednorodności. Badania nad niektórymi z tych chorób dostarczyły intrygującego, nowego wglądu w funkcje białek zaangażowanych na przykład w proces translacji, dowody sugerują, że kilka z nich ma inne funkcje oprócz ich roli w translacji. Biorąc pod uwagę liczne białka zaangażowane w translację mRNA, prawdopodobne jest, że dalsze choroby dziedziczne okażą się spowodowane mutacjami w genach zaangażowanych w ten złożony proces.


Bibliografia

Taylor, J.P., Hardy, J. i Fischbeck, K.H. Toksyczne białka w chorobie neurodegeneracyjnej. Nauki ścisłe 296, 1991–1995 (2002).

Bates, G. Agregacja i toksyczność Huntingtona w chorobie Huntingtona. Lancet 361, 1642–1644 (2003).

Caughey, B. i Lansbury, P.T. Protofibryle, pory, fibryle i neurodegeneracja: oddzielanie odpowiedzialnych agregatów białkowych od niewinnych obserwatorów. Annu. Ks. Neurosci. 26, 267–298 (2003).

Berke, SJ & Paulson, H.L. Agregacja białek i szlak proteasomu ubikwityny: zdobywanie przewagi nad neurodegeneracją. Aktualn. Opinia. Genet. Odw. 13, 253–261 (2003).

Ross, Kalifornia & Pickart, C. Szlak ubikwityna-proteasom w chorobie Parkinsona i innych chorobach neurodegeneracyjnych. Trendy Biol. (2004).

Nussbaum, RL i Ellis, choroba Alzheimera CE i choroba Parkinsona. N. Engl. J. Med. 348, 1356–1364 (2003).

Wong, PC, Cai, H., Borchelt, D.R. & Price, D.L. Genetycznie zmodyfikowane mysie modele chorób neurodegeneracyjnych. Nat. Neurosci. 5, 633–639 (2002).

Ross, Kalifornia Gdy więcej znaczy mniej: patogeneza glutaminy powtarza choroby neurodegeneracyjne. Neuron 15, 493–496 (1995).

Selkoe, D.J. Składanie białek w fatalny sposób. Natura 426, 900–904 (2003).

Davies, SW i in. Tworzenie neuronalnych wtrąceń wewnątrzjądrowych leży u podstaw neurologicznej dysfunkcji u myszy transgenicznych pod kątem mutacji HD. Komórka 90, 537–548 (1997).

Scherzinger, E. i in. Samoorganizacja fragmentów huntingtyny zawierających poliglutaminę we włókna podobne do amyloidu: implikacje dla patologii choroby Huntingtona. Proc. Natl. Acad. Nauka. USA 96, 4604–4609 (1999).

Vonsattel, J.P. i in. Klasyfikacja neuropatologiczna choroby Huntingtona. J. Neuropatol. Do potęgi. Neurol. 44, 559–577 (1985).

Kuemmerle, S. i in. Agregaty Huntingtona mogą nie przewidywać śmierci neuronów w chorobie Huntingtona. Anny. Neurol. 46, 842–849 (1999).

Gutekunst, Kalifornia i in. Agregaty jądrowe i neuropilowe w chorobie Huntingtona: związek z neuropatologią. J. Neurosci. 19, 2522–2534 (1999).

Becher, MW i in. Wewnątrzjądrowe wtrącenia neuronalne w chorobie Huntingtona i atrofii zębowo- przedsionkowej i pallidoluysowej: korelacja między gęstością wtrąceń a długością powtórzeń tripletów IT15 CAG. Neurobiol. Dis. 4, 387–397 (1998).

Myers, R.H. i in. Kliniczna i neuropatologiczna ocena ciężkości choroby Huntingtona. Neurologia 38, 341–347 (1988).

Venkatraman, P., Wetzel, R., Tanaka, M., Nukina, N. i Goldberg, AL Eukariotyczne proteasomy nie mogą trawić sekwencji poliglutaminy i uwalniać ich podczas degradacji białek zawierających poliglutaminę. Mol. Komórka 14, 95–104 (2004).

Huang, CC i in. Tworzenie amyloidu przez zmutowaną huntingtynę: próg, progresja i rekrutacja normalnych białek poliglutaminowych. Somat. Komórka Mol. Genet. 24, 217–233 (1998).

Kazantsev, A., Preisinger, E., Dranovsky, A., Goldgaber, D. i Housman, D. Nierozpuszczalne agregaty odporne na detergenty tworzą się między patologicznymi i niepatologicznymi długościami poliglutaminy w komórkach ssaków. Proc. Natl. Acad. Nauka. USA 96, 11404–11409 (1999).

Margolis, RL i Ross, CA Eksplozja ekspansji: nowe wskazówki dotyczące patogenezy chorób neurodegeneracyjnych z powtórną ekspansją. Trendy Mol. Med. 7, 479–482 (2001).

Orr, H.T. & Zoghbi, HY. Genetyka molekularna SCA1: historia 13-letniej współpracy przeciwko glutaminom. Szum. Mol. Genet. 10, 2307–2311 (2001).

Sen, S., Dash, D., Pasha, S. i Brahmachari, S.K. Rola przerwania histydyny w łagodzeniu patologicznych skutków długich odcinków poliglutaminowych w SCA1: podejście molekularne. Białko Sci. 12, 953–962 (2003).

Selkoe, D.J. Choroba Alzheimera to niewydolność synaptyczna. Nauki ścisłe 298, 789–791 (2002).

Hardy, J. i Selkoe, D.J. Hipoteza amyloidowa choroby Alzheimera: postęp i problemy na drodze do terapii. Nauki ścisłe 297, 353–356 (2002).

Serpell, LC & Smith, J.M. Bezpośrednia wizualizacja struktury arkusza β syntetycznego amyloidu Alzheimera. J. Mol. Biol. 299, 225–231 (2000).

Esler, W.P. i Wolfe, MS Portret sekretaz Alzheimera — nowe funkcje i znajome twarze. Nauki ścisłe 293, 1449–1454 (2001).

Citron, choroba M. Alzheimera: leczenie w odkryciu i rozwoju. Nat. Neurosci. 5 (suppl.), 1055-1057 (2002).

Goedert, białko M. Tau i neurodegeneracja. Nasienie. Odw. komórki Biol. 15, 45–49 (2004).

Ingram, EM i Spillantini, M.G. Mutacje genu Tau: analiza patogenezy FTDP-17. Trendy Mol. Med. 8, 555–562 (2002).

Forno, L.S. Neuropatologia choroby Parkinsona. J. Neuropatol. Do potęgi. Neurol. 55, 259–272 (1996).

Dawson, T.M. & Dawson, V.L. Rzadkie mutacje genetyczne rzucają światło na patogenezę choroby Parkinsona. J. Clin. Inwestować 111, 145–151 (2003).

Valente, E.M. i in. Dziedziczna choroba Parkinsona o wczesnym początku spowodowana mutacjami w PINK1. Nauki ścisłe 304, 1158–1160 (2004).

Cleveland, D.W. & Rothstein, JD Od Charcota do Lou Gehriga: rozszyfrowanie selektywnej śmierci neuronów ruchowych w ALS. Nat. Ks. Neurosci. 2, 806–819 (2001).

Bruijn, LI. i in. Agregacja i toksyczność neuronów ruchowych mutanta SOD1 związanego z ALS niezależnie od SOD1 typu dzikiego. Nauki ścisłe 281, 1851–1854 (1998).

Rakhit, R. i in. Wywołane utlenianiem nieprawidłowe fałdowanie i agregacja dysmutazy ponadtlenkowej i jej implikacje dla stwardnienia zanikowego bocznego. J. Biol. Chem. 277, 47551–47556 (2002).

Prusiner, S.B. Wykład Shattucka — choroby neurodegeneracyjne i priony. N. Engl. J. Med. 344, 1516–1526 (2001).

Lindquist, S., Krobitsch, S., Li, L. i Sondheimer, N. Badanie dziedziczenia i choroby drożdży opartej na konformacji białka. Phil. Przeł. R. Soc. Londyn. b 356, 169–176 (2001).

Scheibel, T., Bloom, J. i Lindquist, S.L. Wydłużanie włókien prionowych drożdży obejmuje oddzielne etapy asocjacji i konwersji. Proc. Natl. Acad. Nauka. USA 101, 2287–2292 (2004).

Ma, J., Wollmann, R. i Lindquist, S. Neurotoksyczność i neurodegeneracja, gdy PrP gromadzi się w cytozolu. Nauki ścisłe 298, 1781–1785 (2002).

Ma, J. & Lindquist, S. Konwersja PrP do samoutrwalającej się konformacji podobnej do PrPSc w cytozolu. Nauki ścisłe 298, 1785–1788 (2002).

Eanes, E.D. i Glenner, G.G. Badania dyfrakcji rentgenowskiej na włóknach amyloidowych. J. Histochem. Cytochem. 16, 673–677 (1968).

Sunde, M. i Blake, C.C. Od stanu kulistego do stanu włóknistego: struktura białka i konwersja strukturalna w tworzeniu amyloidu. Q. Rev. Biophys. 31, 1–39 (1998).

Benzinger, T.L. i in. Propagująca struktura β-amyloidu Alzheimera (10–35) to równoległa β-kartka z resztami w dokładnym rejestrze. Proc. Natl. Acad. Nauka. USA 95, 13407–13412 (1998).

Tycko, R. Wgląd w problem fałdowania amyloidu na podstawie NMR w stanie stałym. Biochemia 42, 3151–3159 (2003).

Torok, M. i in. Cechy strukturalne i dynamiczne peptydu Aβ Alzheimera we włókienkach amyloidu badane za pomocą ukierunkowanego znakowania spinu. J. Biol. Chem. 277, 40810–40815 (2002).

Der-Sarkissian, A., Jao, CC, Chen, J. & Langen, R. Strukturalna organizacja włókienek α-synukleiny badana za pomocą ukierunkowanego znakowania spinów. J. Biol. Chem. 278, 37530–37535 (2003).

Benzinger, T.L. i in. Dwuwymiarowa struktura włókienek β-amyloidu(10–35). Biochemia 39, 3491–3499 (2000).

Balbach, J.J. i in. Tworzenie włókienek amyloidu przez Aβ16-22, siedmio-resztowy fragment peptydu β-amyloidu Alzheimera oraz charakterystyka strukturalna za pomocą NMR w stanie stałym. Biochemia 39, 13748–13759 (2000).

Williams, A.D. i in. Mapowanie struktury drugorzędowej włókienek amyloidu Aβ przy użyciu skanowania mutagenezy proliny. J. Mol. Biol. 335, 833–842 (2004).

Thakur, A.K. & Wetzel, R. Mutacyjna analiza organizacji strukturalnej agregatów poliglutaminowych. Proc. Natl. Acad. Nauka. USA 99, 17014–17019 (2002).

Ross, CA, Poirier, MA, Wanker, EE i Amzel, M. Fibrillogeneza poliglutaminy: ścieżka się rozwija. Proc. Natl. Acad. Nauka. USA 100, 1–3 (2003).

Chen, S., Berthelier, V., Hamilton, J.B., O'Nuallain, B. & Wetzel, R. Amyloidopodobne cechy agregatów poliglutaminowych i ich kinetyka składania. Biochemia 41, 7391–7399 (2002).

O'Nuallain, B. & Wetzel, R. Conformational Abs rozpoznający ogólny epitop włókienka amyloidu. Proc. Natl. Acad. Nauka. USA 99, 1485–1490 (2002).

Uversky, V.N. Ponowne składanie białek. Łańcuch polipeptydowy na skrzyżowaniu: fałdowanie – nieprawidłowe fałdowanie – niefałdowanie: w którą stronę iść? Komórka Mol. Życie Sci. 60, 1852–1871 (2003).

Clarke, G. i in. Jednorazowy model śmierci komórki w dziedzicznych zwyrodnieniach neuronalnych. Natura 406, 195–199 (2000).

Dobson, CM Zasady fałdowania, nieprawidłowego fałdowania i agregacji białek. Nasienie. Odw. komórki Biol. 15, 3–16 (2004).

Sacchettini, J.C. i Kelly, J.W. Strategie terapeutyczne w ludzkich chorobach amyloidowych. Nat. Rev. Drug Discov. 1, 267–275 (2002).

Lansbury, PT, Jr. Neurologia strukturalna: czy nasiona są źródłem zwyrodnienia neuronów? Neuron 19, 1151–1154 (1997).

Soto, C. Wyjaśnienie roli nieprawidłowego fałdowania białek w chorobach neurodegeneracyjnych. Nat. Ks. Neurosci. 4, 49–60 (2003).

Singleton, AB i in. Potrójność locus α-synukleiny powoduje chorobę Parkinsona. Nauki ścisłe 302, 841 (2003).

Singleton, A., Myers, A. i Hardy, J. Prawo masowego działania stosowane w chorobie neurodegeneracyjnej: hipoteza dotycząca etiologii i patogenezy złożonych chorób. Szum. Mol. Genet. 13 (nr specjalny 1), R123–R126 (2004).

Conway, K.A., Rochet, J.C., Bieganski, R.M. & Lansbury, PT, Jr. Kinetyczna stabilizacja protofibryli α-synukleiny przez addukt dopaminy-α-synukleiny. Nauki ścisłe 294, 1346–1349 (2001).

Giasson, B.I. i in. Uszkodzenia oksydacyjne związane z neurodegeneracją przez selektywną nitrację α-synukleiny w zmianach synukleinopatii. Nauki ścisłe 290, 985–989 (2000).

Iwatsubo, T. i in. Oczyszczanie i charakterystyka ciał Lewy'ego z mózgów pacjentów z rozlaną chorobą ciał Lewy'ego. Jestem. J. Pathol. 148, 1517–1529 (1996).

Iwatsubo, T. Agregacja α-synukleiny w patogenezie choroby Parkinsona. J. Neurol. 250 (dodatek 3), III11–III14 (2003).

Okochi, M. i in. Konstytutywna fosforylacja α-synukleiny związanej z chorobą Parkinsona. J. Biol. Chem. 275, 390–397 (2000).

Spillantini, M.G. i in. α-synukleina w ciałach Lewy'ego. Natura 388, 839–840 (1997).

Emamian, E.S. i in. Seryna 776 ataksyny-1 jest krytyczna dla choroby wywołanej poliglutaminą u myszy transgenicznych SCA1. Neuron 38, 375–387 (2003).

Steffan, J.S. i in. Modyfikacja patologii Huntingtyny i choroby Huntingtona. Nauki ścisłe 304, 100–104 (2004).

DiFiglia, M. i in. Agregacja huntingtyny w neuronalnych inkluzjach wewnątrzjądrowych i neurytach dystroficznych w mózgu. Nauki ścisłe 277, 1990–1993 (1997).

Saudou, F., Finkbeiner, S., Devys, D. i Greenberg, ME Huntingtyna działa w jądrze w celu wywołania apoptozy, ale śmierć nie koreluje z tworzeniem się wtrąceń wewnątrzjądrowych. Komórka 95, 55–66 (1998).

Peters, MF i in. Celowanie jądrowe zmutowanej huntingtyny zwiększa toksyczność. Mol. Neurologia komórkowa. 14, 121–128 (1999).

de Almeida, LP, Ross, CA, Zala, D., Aebischer, P. i Deglon, N. Dostarczanie zmutowanej huntingtyny w prążkowiu szczurów za pośrednictwem lentiwirusa indukuje selektywną neuropatologię modulowaną przez wielkość powtórzeń poliglutaminowych, poziomy ekspresji huntingtyny i długość białka. J. Neurosci. 22, 3473–3483 (2002).

Wellington, CL i in. Rozszczepienie przez kaspazę zmutowanej huntingtyny poprzedza neurodegenerację w chorobie Huntingtona. J. Neurosci. 22, 7862–7872 (2002).

Gafni, J. i in. Hamowanie rozszczepiania kalpainy przez huntingtynę zmniejsza toksyczność: nagromadzenie fragmentów kalpainy/kaspazy w jądrze. J. Biol. Chem. 279, 21211–21220 (2004).

Lunkes, A. i in. Proteazy działające na zmutowaną huntingtynę wytwarzają rozszczepione produkty, które w różny sposób tworzą wtrącenia cytoplazmatyczne i jądrowe. Mol. Komórka 10, 259–269 (2002).

Poirier, MA i in. Sferoidy i protofibryle huntingtyny jako prekursory w fibrylizacji poliglutaminy. J. Biol. Chem. 277, 41032–41037 (2002).

Nucifora, FC, Jr. i in. Jądrowa lokalizacja niekaspazowego produktu atrofiny-1, z rozszerzonym powtórzeniem poliglutaminowym, zwiększa toksyczność komórkową. J. Biol. Chem. 278, 13047–13055 (2003).

Lee, EN i in. Tetrasulfoniany ftalocyjaniny wpływają na tworzenie amyloidu i cytotoksyczność α-synukleiny. Biochemia 43, 3704–3715 (2004).

Buxbaum, JN Choroby konformacji białek: co robić in vitro eksperymenty powiedzą nam o tym in vivo choroby? Trendy Biochem. Nauka. 28, 585–592 (2003).

Wetzel, R. Idee porządku dla struktury włókienek amyloidu. Struktura (Camb) 10, 1031–1036 (2002).

Soreghan, B., Kosmoski, J. & Glabe, C. Właściwości powierzchniowo czynne peptydów Aβ Alzheimera i mechanizm agregacji amyloidu. J. Biol. Chem. 269, 28551–28554 (1994).

Harper, J.D., Lieber, CM. & Lansbury, PT, Jr. Obrazowanie mikroskopowe sił atomowych tworzenia zaszczepionych włókienek i rozgałęzień włókienek przez białko amyloidu-β choroby Alzheimera. Chem. Biol. 4, 951–959 (1997).

Lambert, MP i in. Dyfuzyjne, niewłókniste ligandy pochodzące z Aβ1–42 są silnymi neurotoksynami ośrodkowego układu nerwowego. Proc. Natl. Acad. Nauka. USA 95, 6448–6453 (1998).

Harper, J.D., Wong, S.S., Lieber, C.M. & Lansbury, PT, Jr. Zgromadzenie protofibryli amyloidowych Aβ: an in vitro model możliwego wczesnego zdarzenia w chorobie Alzheimera. Biochemia 38, 8972–8980 (1999).

Harper, JD i Lansbury, PT, Jr. Modele wysiewu amyloidu w chorobie Alzheimera i trzęsawce: prawdy mechanistyczne i fizjologiczne konsekwencje zależnej od czasu rozpuszczalności białek amyloidowych. Annu. Ks. Biochem. 66, 385–407 (1997).

Walsh D.M., Lomakin A., Benedek G.B., Condron M.M. & Teplow, DB Fibrillogeneza amyloidu β-białka. Wykrywanie protofibrylarnego produktu pośredniego. J. Biol. Chem. 272, 22364–22372 (1997).

Klein, W.L., Krafft, G.A. & Finch, CE Celowanie w małe oligomery Aβ: rozwiązanie zagadki choroby Alzheimera? Trendy Neurosci. 24, 219–224 (2001).

Terry, R.D. i in. Fizyczne podstawy zmian poznawczych w chorobie Alzheimera: utrata synaps jest głównym korelatem upośledzenia funkcji poznawczych. Anny. Neurol. 30, 572–580 (1991).

McLean, Kalifornia i in. Rozpuszczalna pula amyloidu Aβ jako wyznacznik ciężkości neurodegeneracji w chorobie Alzheimera. Anny. Neurol. 46, 860–866 (1999).

Lue, L.F. i in. Stężenie rozpuszczalnego amyloidu β jako predyktor zmian synaptycznych w chorobie Alzheimera. Jestem. J. Pathol. 155, 853–862 (1999).

Walsh, D.M. i in. Naturalnie wydzielane oligomery białka amyloidu β silnie hamują długotrwałe wzmocnienie hipokampa in vivo. Natura 416, 535–539 (2002).

Volles, M.J. i in. Permeabilizacja pęcherzyków przez protofibrylarną α-synukleinę: implikacje dla patogenezy i leczenia choroby Parkinsona. Biochemia 40, 7812–7819 (2001).

Sharon, R. i in. Tworzenie się wysoce rozpuszczalnych oligomerów α-synukleiny jest regulowane przez kwasy tłuszczowe i nasilone w chorobie Parkinsona. Neuron 37, 583–595 (2003).

Chen, S., Berthelier, V., Yang, W. i Wetzel, R. Zachowanie agregacji poliglutaminy in vitro wspiera mechanizm rekrutacji cytotoksyczności. J. Mol. Biol. 311, 173–182 (2001).

Sanchez, I., Mahlke, C. i Yuan, J. Kluczowa rola oligomeryzacji w rozszerzonych zaburzeniach neurodegeneracyjnych poliglutaminowych. Natura 421, 373–379 (2003).

Nucifora, FC, Jr. i in. Zakłócenie przez huntingtynę i atrofinę-1 transkrypcji za pośrednictwem CBP prowadzące do toksyczności komórkowej. Nauki ścisłe 291, 2423–2428 (2001).

Jiang, H., Nucifora, FC, Jr., Ross, CA. & DeFranco, DB Śmierć komórki wywołana przez huntingtynę ekspandowaną poliglutaminą w linii komórek neuronalnych jest związana z degradacją białka wiążącego CREB. Szum. Mol. Genet. 12, 1–12 (2003).

Bence, N.F., Sampat, R.M. & Kopito, RR Uszkodzenie układu ubikwityna-proteasom przez agregację białek. Nauki ścisłe 292, 1552–1555 (2001).

Kayed, R. i in. Wspólna struktura rozpuszczalnych oligomerów amyloidu implikuje wspólny mechanizm patogenezy. Nauki ścisłe 300, 486–489 (2003).

McClellan, AJ. & Frydman, J. Opiekunowie molekularni i sztuka rozpoznawania przegranej sprawy. Nat. Biol. 3, E51–E53 (2001).

Goldberg, A.L. Degradacja białek i ochrona przed nieprawidłowo sfałdowanymi lub uszkodzonymi białkami. Natura 426, 895–899 (2003).

Ciechanover, A. & Brundin, P. System proteasomu ubikwityny w chorobach neurodegeneracyjnych: czasami kurczak, czasami jajko. Neuron 40, 427–446 (2003).

Kopito, RR Aggresomy, ciała inkluzyjne i agregacja białek. Trendy Biol. 10, 524–530 (2000).

Ravikumar, B. i in. Inhibitor mTOR indukuje autofagię i zmniejsza toksyczność ekspansji poliglutaminy w muchowych i mysich modelach choroby Huntingtona. Nat. Genet. 36, 585–595 (2004).

Tanaka, M. i in. Aggresomy utworzone przez α-synukleinę i synfilinę-1 działają cytoochronnie. J. Biol. Chem. 279, 4625–4631 (2004).

Verhoef, L.G., Lindsten, K., Masucci, M.G. i Dantuma, N.P. Tworzenie agregatów hamuje degradację proteasomów białek poliglutaminowych. Szum. Mol. Genet. 11, 2689–2700 (2002).

Winklhofer, K.F., Reintjes, A., Hoener, MC, Voellmy, R. i Tatzelt, J.Geldanamycyna przywraca wadliwą odpowiedź na szok cieplny in vivo. J. Biol. Chem. 276, 45160–45167 (2001).

Piper, P.W. Chaperon Hsp90 jako obiecujący cel leków. Aktualn. Opinia. Dochodzenie. Leki 2, 1606–1610 (2001).

Yamamoto, A., Lucas, J.J. & Hen, R. Odwrócenie neuropatologii i dysfunkcji motorycznych w warunkowym modelu choroby Huntingtona. Komórka 101, 57–66 (2000).

Davidson, B.L. & Paulson, H.L. Medycyna molekularna dla mózgu: wyciszanie genów chorobowych za pomocą interferencji RNA. Lancet Neurol. 3, 145–149 (2004).

Miller, W.M. i in. Wyciszanie specyficznych dla alleli genów dominujących chorób. Proc. Natl. Acad. Nauka. USA 100, 7195–7200 (2003).

Monsonego, A. i Weiner, H.L. Immunoterapeutyczne podejścia do choroby Alzheimera. Nauki ścisłe 302, 834–838 (2003).

Mattson, MP & Chan, SL Dobre i złe przeciwciała amyloidowe. Nauki ścisłe 301, 1847–1849 (2003).

Weiner, H.L. i Selkoe, D.J. Szczepienia zapalne i lecznicze w chorobach OUN. Natura 420, 879–884 (2002).

Tanaka, M. i in. Trehaloza łagodzi patologię, w której pośredniczy poliglutamina w mysim modelu choroby Huntingtona. Nat. Med. 10, 148–154 (2004).

Bohrmann, B. i in. Samoorganizacja β-amyloidu 42 jest opóźniana przez drobnocząsteczkowe ligandy na etapie strukturalnych związków pośrednich. J. Strut. Biol. 130, 232–246 (2000).

Wood, S.J., MacKenzie, L., Maleeff, B., Hurle, MR & amp Wetzel, R. Selektywne hamowanie tworzenia włókienek Aβ. J. Biol. Chem. 271, 4086–4092 (1996).

Reixach N., Crooks E., Ostresh J.M., Houghten R.A. & Blondeelle, SE Hamowanie neurotoksyczności indukowanej β-amyloidem przez imidazopirydoindole pochodzące z syntetycznej biblioteki kombinatorycznej. J. Strukt. Biol. 130, 247–258 (2000).

maj, p.n.e. i in. Silne hamowanie replikacji prionów trzęsawki w hodowanych komórkach przez bis-akrydyny. Proc. Natl. Acad. Nauka. USA 100, 3416–3421 (2003).

Cordeiro, Y., Lima, LM, Gomes, MP, Foguel, D. i Silva, JL Modulacja oligomeryzacji białek prionowych, agregacja i konwersja arkuszy β przez 4,4'-dianilino-1,1'-binaftyl-5 ,5'-sulfonian (bis-ANS). J. Biol. Chem. 279, 5346–5352 (2004).

Heiser, V. i in. Identyfikacja benzotiazoli jako potencjalnych inhibitorów agregacji poliglutaminy w chorobie Huntingtona za pomocą automatycznego testu opóźnienia filtra. Proc. Natl. Acad. Nauka. USA 99, 16400–16406 (2002).

Pollitt, SK i in. Szybki komórkowy test FRET agregacji poliglutaminy identyfikuje nowy inhibitor. Neuron 40, 685–694 (2003).

John, V., Beck, J.P., Bieńkowski, M.J., Sinha, S. & Heinrikson, R.L. Ludzka β-sekretaza (BACE) i inhibitory BACE. J. Med. Chem. 46, 4625–4630 (2003).

Petkova, AT i in. Model strukturalny włókienek β-amyloidowych w chorobie Alzheimera oparty na ograniczeniach eksperymentalnych NMR w stanie stałym. Proc. Natl. Acad. Nauka. USA 99, 16742–16747 (2002).


Dyskusja

Ten FU gen

W niniejszym artykule FU zidentyfikowano gen i określono jego strukturę. FU składa się z 29 egzonów, z których eksony 1 i 2 kodują 5'UTR, egzon 3 zawiera inicjujący kodon ATG, a eksony 13 i 29 zawierają w ramce kodony stop (ryc. 1). Egzony 1 i 2 mogą służyć jako alternatywne pierwsze egzony, podobnie jak alternatywne egzony 1, 1A i 1B znajdujące się w PTCH1 gen [23]. Egzony 3 do 9 kodują domenę kinazy. Segment ten wykazuje silne podobieństwo do Drosophila fu, podczas gdy pozostała część C-końcowa wykazuje znacznie słabsze podobieństwo [8]. Za pomocą programu DIALIGN [24] możliwe jest dopasowanie fu do L-FU w dwóch regionach w części C-końcowej (nie pokazano). Są one w dużej mierze zakodowane przez eksony 15-16 i 22-29. Wskazuje to, że eksony 10–14 i 17–21 mogły zostać zwerbowane do FU gen podczas ewolucji.

Badania materiału pacjenta Syndactyly

Zbadaliśmy możliwość, że FU leży u podstaw SD1 w oparciu o fakt, że FU leży w przedziale lokalizacji dla SD1 i jest częścią ścieżki sygnałowej Sonic Hedgehog, która uczestniczy w cyfrowym wzorcowaniu [1]. Chociaż zidentyfikowano trzy wcześniej zgłoszone polimorfizmy pojedynczego nukleotydu, nie wykryliśmy żadnej mutacji w FU region kodujący lub flankujące regiony intronowe. Chociaż te wyniki nie implikują FU w przyczynie SD1, możliwe jest, że zaburzenie to jest spowodowane mutacjami w regionach niekodujących, które nie zostały zbadane w tym badaniu. Alternatywnie, SD1 może być spowodowane rearanżacją genomową niezidentyfikowaną za pomocą analizy sekwencji, chociaż nie wykryto zmienionych prążków u dotkniętego członka rodziny SD1 metodą analizy Southern przy użyciu FU Klon cDNA jako sonda (dane nie pokazane).

Analizy ekspresji

Analizy FU ekspresja wykazała, że ​​transkrypty są wykrywane we wszystkich badanych tkankach. Po raz pierwszy przedstawiono dowody wykazujące, że więcej niż jeden transkrypt może ulegać ekspresji z tego genu. Bloty typu Northern wyraźnie pokazują, że rzeczywiście istnieją transkrypty FU o różnej wielkości. Szacuje się, że w tym przypadku transkrypty są nieco większe niż poprzednio zgłoszone, aw niektórych tkankach widoczny jest więcej niż jeden transkrypt. Z dostępnych analiz transkryptów opartych na cDNA i RT/PCR jasno wynika, że ​​występuje alternatywny splicing. Dodatkowo jasne jest również, że w transkryptach obecne są różne 5'UTR. Co najmniej dwie izoformy białka, oprócz opisanego wcześniej L-FU [8], mogą być produkowane. Izoforma S-FU jest tą, która najbardziej różni się od L-FU, składa się tylko z jednej trzeciej N-końcowej L-FU. Ekspresja S-FU wynika z włączenia eksonu 13 do dojrzałego transkryptu. Ten alternatywny przypadek splicingu został wykryty we wszystkich badanych tkankach i przy pozornie stałym stosunku. Również przypadek regulowanego alternatywnego splicingu został wykryty przez RT/PCR, ale o znacznie mniej dramatycznym wpływie na poziomie białka, ponieważ powoduje on jedynie utratę 21 reszt kodowanych przez ekson 24. Jednak ekspresja ujawnia możliwą specyficzność tkankową regulacja tego alternatywnego przypadku splicingu. Może to dobrze odzwierciedlać, że L-FUΔ24 odgrywa rolę biologiczną inną niż L-FU. Ponieważ wydaje się, że mRNA dla L-FUΔ24 nie ulega ekspresji w jelicie cienkim i prostacie, można spekulować, że FU odgrywa tam inną rolę, jeśli zamek leucynowy jest rzeczywiście tracony w L-FUΔ24. Intrygujące jest to, że jądro wydaje się wyrażać transkrypty zarówno z, jak i bez segmentu 63 pz, a także jest tkanką o najsilniejszej ekspresji. Być może ekspresja L-FUΔ24 i L-FU razem jest powiązana z funkcją jeża pustynnego, która, jak wykazano, odgrywa szczególną rolę w spermatogenezie [25]. To, czy interakcje z białkami GLI, SUFU lub innymi składnikami szlaku sygnałowego są zmienione i czy ma to jakikolwiek wpływ na aktywność GLI lub SUFU, pozostaje do zbadania. Z pewnością dodaje to kolejną zmienną do skomplikowanego obrazu sygnalizacji Hedgehog i regulacji GLI u kręgowców.

Badania funkcjonalne i perspektywy

Ocena funkcjonalności ujawniła, że ​​S-FU nie był w stanie regulować GLI1 lub GLI2 podczas ekspresji w komórkach 293. W przeciwieństwie do tego, zarówno L-FU, jak i wariant pozbawiony pełnej domeny kinazy (2HFU) były zdolne do wzmocnienia transkrypcji indukowanej przez GLI2. Wyniki te są jakościowo zbliżone do wyników wcześniej opisywanych w komórkach C3H/10T½ [8]. L-FU i 2HFU były zdolne jedynie do zwiększenia aktywności GLI2 2 do 3-krotnie w komórkach 293, podczas gdy 5 do 8-krotne indukcje obserwuje się w komórkach C3H/10T½. Może to odzwierciedlać fakt, że ta ostatnia linia komórkowa wyraża dodatkowe składniki szlaku sygnałowego Hedgehog, które są wymagane do pełnej aktywności FU. W przeciwieństwie do poprzednich badań [8] nie było możliwe zaobserwowanie wpływu L-FU na SUFU. Ponownie tę różnicę można wytłumaczyć różnymi właściwościami użytych linii komórkowych. Zrozumienie zdarzeń sygnalizacyjnych za SMO może ujawnić różnice funkcjonalne zaangażowanych białek w porównaniu z ich odpowiednikami z muszki owocowej. Chociaż SUFU hamuje czynniki transkrypcyjne GLI, a su(fu) hamuje Ci, nadal istnieją uderzające różnice. Jak dotąd nie było doniesień o odpowiedniku cos2 u kręgowców. Zamiast tego zaobserwowano, że FU oddziałuje ze wszystkimi białkami GLI i SUFU [8], mimo że fu nie wiąże się z Ci [26]. Zaobserwowano również, że w jądrze można znaleźć zarówno L-FU, jak i SUFU [5–8], czego nie zaobserwowano w przypadku fu ani su(fu). Jest prawdopodobne, że zarówno FU, jak i SUFU są transportowane do i z jądra poprzez wiązanie się z białkami GLI [5, 8]. Chociaż zachowano podstawowe działania zarówno FU, jak i SUFU w regulacji GLI, wydaje się również, że istnieją znaczące różnice w porównaniu z ich odpowiednikami z muszki owocowej. Najwyraźniej FU nie ma wpływu na GLI1 podobnego do tego obserwowanego na GLI2. Potrzebne są dodatkowe badania w celu ustalenia roli FU w sygnalizacji jeża i kontroli GLI. Rola różnych izoform również pozostaje do wyjaśnienia. Muszą być one indywidualnie testowane pod kątem regulacji wszystkich białek GLI i produktów proteolitycznych. Wiadomo, że Fu ma co najmniej dwie oddzielne funkcje fizjologiczne u muchy, z których jedna jest zależna od domeny kinazy [27]. Podobnie, FU może mieć dwie lub więcej różnych funkcji w sygnalizacji, reprezentowanych przez różne domeny, izoformy i interakcje białkowe.


Wyniki

Mutacje pacjentów w KDM5C

Uzyskaliśmy fibroblasty od siedmiu pacjentów cierpiących na XLID spowodowane czterema niezależnymi mutacjami w KDM5C (Tabela 1). Lokalizacja mutacji w odniesieniu do opisanych cech białka KDM5C pokazano na Figurze 1A. Mutacje i objawy kliniczne opisano wcześniej dla p.D402Y (12), p.P480L (22) i c.2T>gtC (23). Pacjent z mutacją c.3223delG (p.V1075Yfs*2) wykazywał ciężkie ID, z opóźnieniem rozwojowym, niskim wzrostem (5-10 centyl) i hiperrefleksją. Pacjent 3223delG-1 chodził w wieku 22 miesięcy, w wieku 13,5 lat używał tylko 6–8 słów i wykazuje zez, wysokie wąskie podniebienie i zaparcia. Zbadaliśmy również fibroblasty od heterozygotycznej żeńskiej nosicielki mutacji c.3223delG (matka 3223delG-HET chorego mężczyzny), która wymagała korepetycji w szkole i ma bardzo wąskie podniebienie. Siostra pacjenta (nie badana) jest również nosicielką mutacji i wykazuje lekką niepełnosprawność intelektualną, opóźnienie rozwoju, hiperrefleksję i wysokie wąskie podniebienie, co sugeruje, że mutacja może być szkodliwa w środowisku heterozygotycznym. Dla kontroli otrzymaliśmy fibroblasty napletka BJ od dr George Q Daley (Boston Children's Hospital) i kontrolne fibroblasty skóry męskiej z Coriell Cell Repository (Kontrola-1: GM03348, 10 lat Kontrola-2: AG06234, 17 lat).

Informacje dotyczące fibroblastów pacjenta

. Identyfikator pacjenta . Rodzina . Wiek w momencie biopsji (rok) . Mutacja cDNA . Mutacja białka . NS . Uwagi kliniczne .
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, agresja
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, rzadkie drgawki, agresja
P480L-1 13185 K9330 8 c.1439C>T p.P480L Umiarkowany DD, zez, łagodna skolioza
P480L-2 13186 K9330 1 c.1439C>T p.P480L Łagodny: lekki DD, niski wzrost, drżenie, drgawki, agresja
2T>C-1 13008 23 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, zez, drgawki, ataksja, agresja
2T>C-2 13009 13 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, ataksja,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Ciężki: Silny DD, niski wzrost, zez, hiperrefleksja,
. Identyfikator pacjenta . Rodzina . Wiek w momencie biopsji (rok) . Mutacja cDNA . Mutacja białka . NS . Uwagi kliniczne .
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, agresja
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, rzadkie drgawki, agresja
P480L-1 13185 K9330 8 c.1439C>T p.P480L Umiarkowany DD, zez, łagodna skolioza
P480L-2 13186 K9330 1 c.1439C>T p.P480L Łagodny: lekki DD, niski wzrost, drżenie, drgawki, agresja
2T>C-1 13008 23 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, zez, drgawki, ataksja, agresja
2T>C-2 13009 13 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, ataksja,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Ciężki: Silny DD, niski wzrost, zez, hiperrefleksja,

Adnotacje na podstawie wariantu transkryptu 1 specyficznego dla homo sapiens lizyny (K) demetylazy 5C (KDM5C) (uc004drz.3/NM_004187) w zestawie genomu GRCh38/hg38.

ID, niepełnosprawność intelektualna DD, opóźnienie rozwojowe.

Informacje dotyczące fibroblastów pacjenta

. Identyfikator pacjenta . Rodzina . Wiek w momencie biopsji (rok) . Mutacja cDNA . Mutacja białka . NS . Uwagi kliniczne .
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, agresja
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, rzadkie drgawki, agresja
P480L-1 13185 K9330 8 c.1439C>T p.P480L Umiarkowany DD, zez, łagodna skolioza
P480L-2 13186 K9330 1 c.1439C>T p.P480L Łagodny: lekki DD, niski wzrost, drżenie, drgawki, agresja
2T>C-1 13008 23 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, zez, drgawki, ataksja, agresja
2T>C-2 13009 13 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, ataksja,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Ciężki: Silny DD, niski wzrost, zez, hiperrefleksja,
. Identyfikator pacjenta . Rodzina . Wiek w momencie biopsji (rok) . Mutacja cDNA . Mutacja białka . NS . Uwagi kliniczne .
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, agresja
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Umiarkowany do ciężkiego DD, niski wzrost, rzadkie drgawki, agresja
P480L-1 13185 K9330 8 c.1439C>T p.P480L Umiarkowany DD, zez, łagodna skolioza
P480L-2 13186 K9330 1 c.1439C>T p.P480L Łagodny: lekki DD, niski wzrost, drżenie, drgawki, agresja
2T>C-1 13008 23 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, zez, drgawki, ataksja, agresja
2T>C-2 13009 13 c.2T>C p.M1_E165del Ciężki: Silny DD, niski wzrost, ataksja,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Ciężki: Silny DD, niski wzrost, zez, hiperrefleksja,

Adnotacje na podstawie wariantu transkryptu 1 specyficznego dla homo sapiens lizyny (K) demetylazy 5C (KDM5C) (uc004drz.3/NM_004187) w zespole genomu GRCh38/hg38.

ID, niepełnosprawność intelektualna DD, opóźnienie rozwojowe.

Mutacja c.3223delG wyklucza ekspresję KDM5C, ale inne mutacje pacjentów są kompatybilne z produkcją transkryptu i białka. (A) Schemat struktury białka KDM5C ze wskazanymi domenami i mutacjami pacjenta. M166 to przewidywany kodon start dla pacjentów z mutacją c.2T>C. Przeciwciało KDM5C powstaje przeciwko C-końcowym 100 aminokwasom białka. (b) Analiza KDM5C RNA amplifikowane przy użyciu losowych starterów (wypełnione słupki) lub starterów oligo dT (puste słupki) pokazuje, że KDM5C RNA wykrywa się u dotkniętych samców wykazujących mutacje p.D402Y, p.P480L lub c.2T>gtC, ale nie u chorego samca z mutacją c.3223delG. Wyświetlana jest średnia i odchylenie standardowe 3-4 niezależnych eksperymentów (*P <0,01 w porównaniu z kontrolą-1, badanie Studenta T-test). RNA wykryto za pomocą starterów obejmujących połączenia ekson-egzon i znormalizowano do genu porządkowego RSP18 a następnie fibroblasty Control-1. (C) Lizaty całych komórek z fibroblastów skóry pacjentów wykazują ekspresję białka KDM5C u chorych mężczyzn wykazujących mutacje p.P480L i p.D402Y. Nie wykryto ekspresji u mężczyzny dotkniętego c.3223delG. Samce niosące mutację c.2T>C wytwarzają skrócony produkt KDM5C. Najniższe pasmo x jest niespecyficzne. TUBULIN, kontrola załadunku. (D) KDM5C shRNA zmniejszają się KDM5C transkrypt w kontrolnych fibroblastach BJ i c.2T>C. Wyświetlana jest średnia i odchylenie standardowe dwóch niezależnych eksperymentów (*P <0,05 w porównaniu z FF, Studenta T-test). RNA wykryto za pomocą starterów obejmujących połączenia ekson-egzon i znormalizowano do genu porządkowego RSP18 a następnie kontrolne próbki shRNA (FF, lucyferaza świetlika). (mi) Western blot pokazuje, że skrócony produkt wytworzony w fibroblastach c.2T>C jest redukowany po traktowaniu KDM5C-shRNA, co sugeruje, że jest on specyficzny. Najniższe pasmo x jest niespecyficzne. ACTIN, kontrola załadunku.

Mutacja c.3223delG wyklucza ekspresję KDM5C, ale inne mutacje pacjentów są kompatybilne z produkcją transkryptu i białka. (A) Schemat struktury białka KDM5C ze wskazanymi domenami i mutacjami pacjenta. M166 to przewidywany kodon start dla pacjentów z mutacją c.2T>C. Przeciwciało KDM5C powstaje przeciwko C-końcowym 100 aminokwasom białka. (b) Analiza KDM5C RNA amplifikowane przy użyciu losowych starterów (wypełnione słupki) lub starterów oligo dT (puste słupki) pokazuje, że KDM5C RNA wykrywa się u dotkniętych samców wykazujących mutacje p.D402Y, p.P480L lub c.2T>gtC, ale nie u chorego samca z mutacją c.3223delG. Wyświetlana jest średnia i odchylenie standardowe 3-4 niezależnych eksperymentów (*P <0,01 w porównaniu z kontrolą-1, badanie Studenta T-test). RNA wykryto za pomocą starterów obejmujących połączenia ekson-egzon i znormalizowano do genu porządkowego RSP18 a następnie fibroblasty Control-1. (C) Lizaty całych komórek z fibroblastów skóry pacjentów wykazują ekspresję białka KDM5C u chorych mężczyzn wykazujących mutacje p.P480L i p.D402Y. Nie wykryto ekspresji u mężczyzny dotkniętego c.3223delG. Samce niosące mutację c.2T>C wytwarzają skrócony produkt KDM5C. Najniższe pasmo x jest niespecyficzne. TUBULIN, kontrola załadunku. (D) KDM5C shRNA zmniejszają się KDM5C transkrypt w kontrolnych fibroblastach BJ i c.2T>C. Wyświetlana jest średnia i odchylenie standardowe dwóch niezależnych eksperymentów (*P <0,05 w porównaniu z FF, Studenta T-test). RNA wykryto za pomocą starterów obejmujących połączenia ekson-egzon i znormalizowano do genu porządkowego RSP18 a następnie kontrolne próbki shRNA (FF, lucyferaza świetlika). (mi) Western blot pokazuje, że skrócony produkt wytworzony w fibroblastach c.2T>C jest redukowany po traktowaniu KDM5C-shRNA, co sugeruje, że jest on specyficzny. Najniższe pasmo x jest niespecyficzne. ACTIN, kontrola załadunku.

Mutacje pacjentów obniżają poziom białka KDM5C

Najpierw przeanalizowaliśmy wpływ mutacji genetycznych na poziom ekspresji RNA KDM5C u pacjentów i fibroblastów kontrolnych za pomocą qRT-PCR (ilościowa odwrotna transkrypcja z PCR Ryc. 1B). Przeanalizowaliśmy zarówno całkowite RNA amplifikowane przy użyciu losowych heksamerów (wypełnione słupki), jak i poliadenylowane mRNA amplifikowane przy użyciu starterów oligo dT (puste słupki). Fibroblasty pacjentów niosące mutacje p.D402Y, p.P480L i c.2T>C ulegają ekspresji KDM5C. Nastąpiły jednak znaczne spadki poziomów całkowitego i poliadenylacji KDM5C RNA w fibroblastach z mutacją p.P480L i łącznie KDM5C RNA w fibroblastach z mutacją p.D402Y. KDM5C Poziomy mRNA w fibroblastach c.3223delG drastycznie spadły do ​​~15% kontrolnych linii komórkowych, zgodnie z tym, że wynikowy mRNA jest ukierunkowany na rozkład mRNA za pośrednictwem nonsensu (NMD Fig. 1B). KDM5C Poziomy mRNA u samicy nosicielki c.3223delG były nieznacznie, ale znacznie zmniejszone w porównaniu z kontrolnymi fibroblastami skóry.

KDM5C jest członkiem rodziny demetylaz KDM5, a homologi KDM5C mogą kompensować utratę funkcji KDM5C. Dlatego przeanalizowaliśmy poziom ekspresji mRNA członków rodziny KDM5 KDM5A, KDM5B oraz KDM5D (znany również jako RBP2, PLU-1 oraz SMCY), aby sprawdzić, czy zostały one zmienione w fibroblastach pacjentów z KDM5C mutacje (Materiał Uzupełniający, Ryc. S1 A). Poziomy KDM5A mRNA były porównywalne we wszystkich liniach fibroblastów pacjentów i kontrolnych. Poziomy KDM5B RNA było nieznacznie, ale znacząco zmniejszone w P480L-2, 2T>gtC-1, 3223delG-1 i 3223delG-HET. Połączone w Y SMCY był niewykrywalny u samicy nosicielki zgodnie z oczekiwaniami, ale obecny na podobnym poziomie u dotkniętych chorobą mężczyzn i kontroli.

c.1204G>T i c.1439C>T są mutacjami typu missense, co do których przewiduje się, że powodują powstanie pełnej długości białka KDM5C z podstawieniem aminokwasu w pojedynczej reszcie: odpowiednio p.D402Y i p.P480L. Zgodnie z przewidywaniami, wykryliśmy białko KDM5C o oczekiwanej masie cząsteczkowej (176 kDa) na Western blot lizatów całych komórek z fibroblastów z mutacjami c.1204G>T i c.1439C>T (Fig. 1C) przy użyciu przeciwciała wywołanego przeciwko C-końcowi KDM5C (Rys. 1A). Przeciwnie, przewiduje się, że c.3223delG powoduje mutację przesunięcia ramki odczytu wprowadzającą kodon przedwczesnej terminacji (PTC) w pozycji bezpośrednio po pierwszym zmienionym aminokwasie (p.V1075Yfs*2). Jest to zgodne z niskimi poziomami KDM5C RNA wykryty w fibroblastach 3223delG-1 (ryc. 1B) i przewidywaliśmy brak produkcji białka. Nie wykryliśmy białka KDM5C w fibroblastach c.3223delG (ryc. 1C), ale przeciwciało KDM5C jest podniesione do części KDM5C poza PTC (ryc. 1A) i dlatego nie wykryłoby potencjalnie skróconego produktu. Co ciekawe, wykryliśmy białko KDM5C w fibroblastach z mutacją c.2T>C w kodonie startu translacji KDM5C (Rys. 1C). Białko c.2T>C KDM5C ma niższą masę cząsteczkową niż KDM5C typu dzikiego, co sugeruje wytwarzanie białka w ramce, skróconego na N-końcu. Co ważne, globalne poziomy białka KDM5C są niższe we wszystkich liniach pacjentów w porównaniu z kontrolami (ryc. 1C).

Aby zweryfikować, że prążek o niższej masie cząsteczkowej widoczny w western blotach KDM5C z fibroblastów c.2T>C jest alternatywną wersją KDM5C, potraktowaliśmy fibroblasty kontrolne i c.2T>C za pomocą shRNA KDM5C. Analiza qRT-PCR potwierdziła, że ​​dwa KDM5C shRNA zmniejszyły poziom KDM5C transkrypty w komórkach kontrolnych i komórkach pacjenta c.2T>C w porównaniu z niezainfekowanymi i kontrolnymi próbkami zainfekowanymi shRNA (FF, lucyferaza świetlika) (Fig. 1D). Analiza Western blot wykazała, że KDM5C Konstrukty shRNA zmniejszają sygnał KDM5C pełnej długości w fibroblastach kontrolnych, a także zmniejszają sygnał o niższej masie cząsteczkowej w fibroblastach c.2T>C (Fig. 1E), co potwierdza, że ​​białko rozpoznawane przez przeciwciało KDM5C w tych komórkach pacjenta jest rzeczywiście skróconym KDM5C.

Pacjenci z C.2T>C wyrażają skrócone na N-końcu białko p.M1_E165del KDM5C

Algorytmy przewidywania miejsca inicjacji translacji oparte na sekwencji DNA przewidują, że gdy obecna jest mutacja c.2T>C, translacja KDM5C rozpoczyna się od metioniny (M) w pozycji 166, co sugeruje, że skrócone białko to p.M1_E165del. M166 jest w ramce z kanonicznym kodonem start, zgodnie z rozpoznawaniem formy skróconej przez przeciwciało skierowane przeciwko C-końcowi KDM5C (Fig. 1A). p.M1_E165del jest o 20 kDa mniejszy niż typu dzikiego (156 w porównaniu do 176 kDa), co jest zgodne z różnicą masy cząsteczkowej obserwowaną w westernach (ryc. 1C) i nie ma wysoce konserwatywnych JmjN i ARID (interaktywna domena bogata w AT) domeny (ryc. 1A).

Aby przetestować hipotezę, że komórki pacjenta c.2T>C wytwarzają p.M1_E165del KDM5C, wytworzyliśmy konstrukty ekspresyjne KDM5C znakowane na C-końcu kodującym albo pełnej długości sekwencję kodującą z mutacją c.2T>C, albo skróconą sekwencję kodującą rozpoczynającą się od kodonu M166 (c.A1_A495del). Nadekspresja tych konstruktów w fibroblastach pozbawionych endogennego KDM5C (fibroblasty pacjenta c.3223delG, ryc. 2A) lub w fibroblastach kontrolnych BJ (materiał uzupełniający, ryc. S1 B), a następnie analiza Western blot wykazała, że ​​białka kodowane przez c.2T>C i c.A1_A495del KDM5C działają przy podobnej masie cząsteczkowej, potwierdzając naszą hipotezę. Dane z nadekspresji KDM5C znakowanego na N-końcu z innymi mutacjami pacjenta były zgodne z wynikami z komórek pacjenta: mutacje zmiany sensu p.P480L i p.D402Y wytwarzają białko pełnej długości (ryc. 2A, materiał uzupełniający, ryc. S1 B).

p.M1_E165del KDM5C jest wytwarzany w fibroblastach pacjenta c.2T>C. (A) Nadekspresja KDM5C-Flag-HA w fibroblastach pozbawionych endogennego KDM5C wykazuje podobną wielkość białek z wektora ekspresyjnego c.2T>C KDM5C i jednego rozpoczynającego się od p.M166. Nadekspresja HA-Flag-KDM5C niosącego mutacje pacjenta potwierdza, że ​​p.P480L i p.D402Y są mutacjami zmiany sensu. H514A jest mutacją katalityczną zerową (13). ACTIN, kontrola załadunku. (b) Nadekspresja nieznakowanego KDM5C pokazuje, że KDM5C zaczynając od M166 ma podobną masę cząsteczkową do endogennego KDM5C w fibroblastach pacjenta c.2T>C. Najniższe pasmo x jest niespecyficzne.

p.M1_E165del KDM5C jest wytwarzany w fibroblastach pacjenta c.2T>C. (A) Nadekspresja KDM5C-Flag-HA w fibroblastach pozbawionych endogennego KDM5C wykazuje podobną wielkość białek z wektora ekspresyjnego c.2T>C KDM5C i jednego rozpoczynającego się od p.M166. Nadekspresja HA-Flag-KDM5C niosącego mutacje pacjenta potwierdza, że ​​p.P480L i p.D402Y są mutacjami zmiany sensu. H514A jest mutacją katalityczną zerową (13). ACTIN, kontrola załadunku. (b) Nadekspresja nieznakowanego KDM5C pokazuje, że KDM5C zaczynając od M166 ma podobną masę cząsteczkową do endogennego KDM5C w fibroblastach pacjenta c.2T>C. Najniższe pasmo x jest niespecyficzne.

Następnie dokonaliśmy nadekspresji typu dzikiego lub c.A1_A495del KDM5C bez znaczników w KDM5C- zerowe fibroblasty i porównano masę cząsteczkową powstałego białka z endogennym białkiem KDM5C z fibroblastów kontrolnych lub c.2T>gtC pacjenta (Fig. 2B). Zaobserwowaliśmy, że nadekspresja KDM5C typu dzikiego przebiega z podobną masą cząsteczkową do KDM5C w kontrolnych fibroblastach, jak oczekiwano. Nadekspresja c.A1_A495del wytwarza białko KDM5C, które działa przy podobnej masie cząsteczkowej do endogennego KDM5C w fibroblastach c.2T>C, co sugeruje, że u tych pacjentów wytwarzany jest p.M1_E165del.

P.M1_E165del KDM5C asocjuje z chromatyną

Najpierw oceniliśmy, czy brak domeny wiążącej DNA ARID (24) zapobiega asocjacji p.M1_E165del KDM5C z chromatyną. Aby to przetestować, nadwyrężyliśmy się KDM5C z mutacjami pacjenta lub KDM5C pozbawione domeny JmjN lub ARID i frakcjonowane komórki do cytoplazmy, nukleoplazmy i chromatyny przed western blottingiem dla KDM5C (Fig. 3). Utrata ani domeny JmjN, ani domeny ARID zapobiega wykryciu KDM5C we frakcji chromatyny. Skrócony p.M1_E165del KDM5C znajduje się również we frakcji chromatyny (ryc. 3). Frakcjonowanie linii komórkowych pacjentów c.2T>C potwierdziło endogenne powiązanie z chromatyną (materiał uzupełniający, Fig. S2).

Skrócony c.2T>C KDM5C może łączyć się z chromatyną. Frakcjonowanie KDM5C-puste fibroblasty z nadekspresją KDM5C-Flag-HA pokazują, że KDM5C nie wymaga domen JmjN lub ARID do asocjacji chromatyny. Kontrole ładowania TUBULIN (cytoplazma), P300 (nukleoplazma) i H3 (chromatyna). Prawy panel, kontrola frakcjonowania.

Skrócony c.2T>C KDM5C może łączyć się z chromatyną. Frakcjonowanie KDM5C-puste fibroblasty z nadekspresją KDM5C-Flag-HA pokazują, że KDM5C nie wymaga domen JmjN lub ARID do asocjacji chromatyny. Kontrole ładowania TUBULIN (cytoplazma), P300 (nukleoplazma) i H3 (chromatyna). Prawy panel, kontrola frakcjonowania.

Mutacje pacjentów w KDM5C zmniejszyć stabilność białka

Globalne poziomy białka KDM5C są zmniejszone w fibroblastach pacjenta w porównaniu z kontrolami (ryc. 1C), podczas gdy poziomy RNA są porównywalne (ryc. 1B), co sugeruje, że mutacje pacjenta mogą wpływać na stabilność KDM5C. Aby bezpośrednio przetestować tę hipotezę, przeprowadziliśmy analizy przebiegu w czasie przy użyciu inhibitora translacji cykloheksimidu na fibroblastach kontrolnych i pacjentów (ryc. 4). Białko KDM5C jest stosunkowo stabilne w fibroblastach kontrolnych, z okresem półtrwania co najmniej 12 godzin. Fibroblasty z mutacją zmiany sensu p.D402Y mają okres półtrwania KDM5C około 4 godz., podczas gdy p.P480L KDM5C wykazuje bardziej dramatyczną redukcję do około 2 godz. Fibroblasty z mutacją c.2T>C również wykazują drastycznie zmniejszoną stabilność białka, z okresem półtrwania około 2 h (ryc. 4).

Mutacje pacjentów destabilizują KDM5C. Przebiegi czasowe cykloheksymidu (CHX, 100 μg/ml) na fibroblastach kontrolnych i pacjenta pokazują, że KDM5C w fibroblastach pacjenta z mutacjami c.2T>C, p.P480L i p.D402Y jest mniej stabilny niż KDM5C w fibroblastach kontrolnych. TUBULIN, kontrola załadunku.

Mutacje pacjentów destabilizują KDM5C. Przebiegi czasowe cykloheksymidu (CHX, 100 μg/ml) na fibroblastach kontrolnych i pacjenta pokazują, że KDM5C w fibroblastach pacjenta z mutacjami c.2T>C, p.P480L i p.D402Y jest mniej stabilny niż KDM5C w fibroblastach kontrolnych. TUBULIN, kontrola załadunku.

Podobnie, przebiegi czasowe cykloheksymidu na KDM5C-zerowe fibroblasty z nadekspresją KDM5C z różnymi mutacjami pokazuje, że białka kodowane przez c.2T>C i c.A1_A495del mają znacznie krótszy okres półtrwania niż KDM5C typu dzikiego (Materiał Uzupełniający, Fig. S3). Co ciekawe, zmniejszenie stabilności obserwuje się również dla KDM5C bez domeny JmjN, ale nie dla KDM5C bez domeny ARID, co sugeruje, że to brak domeny JmjN zmniejsza stabilność KDM5C pacjenta c.2T>C (Materiał uzupełniający, ryc. S3 ). Jest to zgodne z tym, że domena JmjN jest ważna dla stabilności w innych demetylazach zawierających JmjC (25, 26).

Mutacje pacjenta w KDM5C zmniejszają jego aktywność demetylazy histonowej

Wykazano, że niektóre mutacje zmiany sensu u pacjentów, w tym p.D402Y, upośledzają aktywność demetylazy KDM5C (13, 14, 17), ale wpływ mutacji p.P480L nie został zbadany. Ponadto, skrócony p.M1_E165del KDM5C wytworzony u pacjentów z c.2T>C zawiera domenę katalityczną JmjC, ale brakuje mu innych wysoce konserwatywnych domen, a jego aktywność demetylazy nie jest znana.

Dlatego zapytaliśmy, czy mutacje pacjentów zmniejszają aktywność demetylazy KDM5C in vitro. Oczyściliśmy KDM5C i KDM5C typu dzikiego zawierające mutację katalityczną zerową [p.H514A] (13) lub mutacje pacjentów (p.D402Y, p.P480L, p.M1_E165del) z komórek owadzich (Fig. 5A). Użyliśmy tych oczyszczonych białek w testach demetylazy na peptydach histonowych (ryc. 5B) lub oczyszczonych histonach (ryc. 5C) i oceniliśmy wyniki odpowiednio za pomocą spektrometrii mas lub western blot przy użyciu przeciwciał modyfikujących histony. Należy zauważyć, że ekspresja i oczyszczanie p.M1_E165del na tym samym poziomie co inne konstrukty (ryc. 5A) nie było możliwe, prawdopodobnie z powodu wrodzonej niestabilności tego białka, co stanowi zastrzeżenie w ocenie jego aktywności demetylazy .

Mutacje zmiany sensu i ponownego startu translacji zmniejszają aktywność demetylazy KDM5C in vitro. (A) Bloty Coomassie i KDM5C KDM5C oczyszczone z komórek owadzich Sf9 i stosowane w testach demetylazy na peptydach (b) lub histony (C). Dzikiego typu KDM5C demetylowane H3K4me3 i H3K4me2 forma katalitycznie zerowa H514A nie ma aktywności. Mutacje p.D402Y, p.P480L i p.M1_E165del zmniejszają aktywność demetylazy KDM5C.

Mutacje zmiany sensu i ponownego startu translacji zmniejszają aktywność demetylazy KDM5C in vitro. (A) Bloty Coomassie i KDM5C KDM5C oczyszczone z komórek owadzich Sf9 i stosowane w testach demetylazy na peptydach (b) lub histony (C). Dzikiego typu KDM5C demetylowane H3K4me3 i H3K4me2 forma katalitycznie zerowa H514A nie ma aktywności. Mutacje p.D402Y, p.P480L i p.M1_E165del zmniejszają aktywność demetylazy KDM5C.

KDM5C typu dzikiego demetyluje peptydy H3K4me2 do H3K4me1 i H3K4me3 do H3K4me2 (ryc. 5B), jak pokazano wcześniej (13, 14). Martwe enzymatycznie białko p.H514A nie wykazuje wykrywalnej aktywności demetylazy na peptydach H3K4me2 lub H3K4me3. Mutacje pacjentów p.P480L i p.D402Y silnie zmniejszają aktywność demetylazy na obu peptydach H3K4me2 i H3K4me3 w porównaniu z KDM5C typu dzikiego, chociaż wykazują resztkową aktywność w porównaniu z mutantem katalitycznie zerowym (ryc. 5B).

Oprócz testów demetylazy z użyciem peptydów histonowych, zbadaliśmy, czy mutacje KDM5C pacjenta zmieniają aktywność demetylazy na oczyszczonych histonach, które są bardziej istotnymi fizjologicznie substratami. KDM5C typu dzikiego demetyluje H3K4me2 i H3K4me3 na oczyszczonych histonach, jak opisano wcześniej, ale nie powoduje istotnych zmian w poziomie H3K4me1, H3K9me3, H3K27me3, H3K36me2 lub H3K36me3 (ryc. 5C). P.H514A katalityczny zerowy KDM5C nie demetyluje oczyszczonych histonów na H3K4me2/3, podobnie jak p.M1_E165del. p.D402Y i p.P480L KDM5C wykazują ograniczoną aktywność demetylazy na H3K4me2, podczas gdy demetylacja H3K4me3 przez p.D402Y lub p.P480L jest porównywalna do tej obserwowanej w przypadku KDM5C typu dzikiego. Różnice w aktywności zmutowanej KDM5C na histonach w porównaniu z peptydami mogą wynikać z obecności dodatkowych modyfikacji na oczyszczonych histonach, które mogą przenikać z metylacją H3K4.

Aby je uzupełnić in vitro Testy dememetylazy, nadekspresjonowaliśmy KDM5C z N-końcowymi (ryc. 6A) lub C-końcowymi znacznikami (materiał uzupełniający, ryc. S4) w kontrolnych fibroblastach i oceniliśmy H3K4me3 na poziomie pojedynczych komórek za pomocą mikroskopii immunofluorescencyjnej. W komórkach wyrażających wysokie poziomy KDM5C typu dzikiego, barwienie H3K4me3 było znacznie zmniejszone (strzałki, Fig. 6A, Materiał Uzupełniający, Fig. S4). Nie miało to miejsca w komórkach wyrażających wysokie poziomy mutanta katalitycznego p.H514A KDM5C, gdzie poziomy H3K4me3 były równe w całej populacji komórek, niezależnie od ich poziomu KDM5C (ryc. 6A, materiał uzupełniający, ryc. S4). Wysokie poziomy p.D402Y indukowały redukcję H3K4me3, podczas gdy barwienie H3K4me3 pozostawało wysokie w komórkach z nadekspresją mutantów p.P480L, p.M1_E165del (ryc. 6A) i c.2T>C (materiał uzupełniający, ryc. S4), co sugeruje, że te mutacje zmniejszają aktywność KDM5C in vivo. Domeny JmjN i ARID są wymagane dla aktywności demetylazy (Materiał Uzupełniający, Fig. S4).

p.P480L i p.M1_E165del KDM5C mają obniżoną aktywność demetylazy ex vivo, a fibroblasty pacjentów wykazują lokalne zmiany ekspresji genów. (A) HA-Flag-KDM5C niosący różne mutacje pacjentów był nadeksprymowany w fibroblastach Control-BJ, a poziomy KDM5C (Flag) i H3K4me3 oceniano metodą immunofluorescencji. Komórki z wysokim WT lub p.D402Y KDM5C wykazywały zmniejszone barwienie H3K4me3, wykazując aktywność demetylazy. Nadekspresja p.H514A, p.P480L i p.M1_E165del KDM5C nie obniżyła poziomów H3K4me3. Strzałki, komórki wyrażające znakowany KDM5C na wysokim poziomie. (b) Kwaśne ekstrakty histonowe z fibroblastów skóry pacjenta nie wykazują stałych zmian w globalnej metylacji H3K4. H3, kontrola załadunku. (C) Zmiany w ekspresji genów w fibroblastach pacjentów w porównaniu z kontrolami. Wyświetlana jest średnia i odchylenie standardowe trzech niezależnych eksperymentów (*P <0,05 w porównaniu z kontrolą-1, badanie Studenta T-test). RNA wykryto za pomocą starterów obejmujących połączenia ekson-egzon i znormalizowano do genu porządkowego RSP18 a następnie Control-1.

p.P480L i p.M1_E165del KDM5C mają obniżoną aktywność demetylazy ex vivo, a fibroblasty pacjentów wykazują lokalne zmiany ekspresji genów. (A) HA-Flag-KDM5C niosący różne mutacje pacjentów był nadeksprymowany w fibroblastach Control-BJ, a poziomy KDM5C (Flag) i H3K4me3 oceniano metodą immunofluorescencji. Komórki z wysokim WT lub p.D402Y KDM5C wykazywały zmniejszone barwienie H3K4me3, wykazując aktywność demetylazy. Nadekspresja p.H514A, p.P480L i p.M1_E165del KDM5C nie obniżyła poziomów H3K4me3. Strzałki, komórki wyrażające znakowany KDM5C na wysokim poziomie. (b) Kwaśne ekstrakty histonowe z fibroblastów skóry pacjenta nie wykazują stałych zmian w globalnej metylacji H3K4. H3, kontrola załadunku. (C) Zmiany w ekspresji genów w fibroblastach pacjentów w porównaniu z kontrolami. Wyświetlana jest średnia i odchylenie standardowe trzech niezależnych eksperymentów (*P <0,05 w porównaniu z kontrolą-1, badanie Studenta T-test). RNA wykryto za pomocą starterów obejmujących połączenia ekson-egzon i znormalizowano do genu porządkowego RSP18 a następnie Control-1.

Fibroblasty pacjentów wykazują zlokalizowane zmiany w ekspresji genów, ale nie globalne zmiany w metylacji histonów

Całkowity poziom metylacji histonów komórkowych jest określany przez wiele różnych metylotransferaz i demetylaz. Ocena wpływu zmniejszonej aktywności KDM5C u pacjentów (ryc. 5 i 6A) na globalną metylację histonów in vivo, wyekstrahowaliśmy histony z fibroblastów pacjentów i kontrolowaliśmy. Western blot nie wykazał spójnej zmiany metylacji H3K4 w fibroblastach pacjentów w porównaniu z kontrolami, co sugeruje, że KDM5C mutacje nie determinują globalnych poziomów metylacji H3K4 (ryc. 6B).

Zmienione wzorce ekspresji genów w XLID niekoniecznie wymagają globalnej zmiany metylacji histonów, ale mogą wynikać ze zlokalizowanych zmian w określonych loci. Jest to zgodne ze zwiększoną ekspresją (27) lub zmniejszoną metylacją DNA (22) w niektórych genach w liniach komórek limfoblastoidalnych i krwi od pacjentów z KDM5C mutacje w porównaniu z kontrolami. Przetestowaliśmy te wcześniej zidentyfikowane geny pod kątem zmian ekspresji w fibroblastach pacjentów w porównaniu z kontrolami przy użyciu qRT-PCR (ryc. 6C). Znaleźliśmy trzy geny, które wykazały znaczną regulację w górę w fibroblastach pacjentów w porównaniu z kontrolami: EMILIN2 (interfejs mikrofibryli elastyny ​​2), TNFSF4 [członek nadrodziny czynnika martwicy nowotworu (ligand) 4] oraz ZMYND12 (palec cynkowy typu MYND zawierający 12). Odkrycia te potwierdzają ideę związanych z XLID lokalnych zmian we wzorcach metylacji H3K4 i ekspresji genów w komórkach pacjentów.


Bibliografia

Kryshtafovych A, Fidelis K, Moult J: Postęp od CASP6 do CASP7. Białka. 2007, 69 (Suplement 8): 194-207. 10.1002/prot.21769.

Grabowski M, Joachimiak A, Otwinowski Z, Minor W: Genomika strukturalna: nadążanie za poszerzaniem wiedzy o wszechświecie białek. Curr Opin Struct Biol. 2007, 17: 347-353. 10.1016/j.sbi.2007.06.003.

Reeves GA, Thornton JM: Integracja danych biologicznych przez genom. Hum Mol Genet. 2006, 15 (Specyfikacja 1): R81-R87. 10.1093/hmg/ddl086.

Prlic A, Down TA, Kulesha E, Finn RD, Kahari A, Hubbard TJ: Integracja sekwencji i biologii strukturalnej z DAS. Bioinformatyka BMC.2007, 8: 333-10.1186/1471-2105-8-333.

Tramontano A: Rola modelowania molekularnego w badaniach biomedycznych. FEBS Lett. 2006, 580: 2928-2934. 10.1016/j.febslet.2006.04.011.

Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G: Ontologia genów: narzędzie do unifikacji biologii. Konsorcjum Ontologii Genów. Nat Genet. 2000, 25: 25-29. 10.1038/75556.

Tress M, Cheng J, Baldi P, Joo K, Lee J, Seo JH, Lee J, Baker D, Chivian D, Kim D, Ezkurdia I: Ocena predykcji przesłanych do kategorii predykcji domeny CASP7. Białka. 2007, 69 (Suppl 8): 137-151. 10.1002/prot.21675.

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Podstawowe narzędzie do wyszukiwania wyrównania lokalnego. J Mol Biol. 1990, 215: 403-410.

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST i PSI-BLAST: nowa generacja programów do przeszukiwania baz danych białek. Kwasy nukleinowe Res. 1997, 25: 3389-3402. 10.1093/nar/25.17.3389.

Wu CH, Nikolskaya A, Huang H, Yeh LS, Natale DA, Vinayaka CR, Hu ZZ, Mazumder R, Kumar S, Kourtesis P, Ledley RS, Suzek BE, Arminski L, Chen Y, Zhang J, Cardenas JL, Chung S , Castro-Alvear J, Dinkov G, Barker WC: PIRSF: system klasyfikacji rodzin w Protein Information Resource. Kwasy nukleinowe Res. 2004, D112-D114. 10.1093/nar/gkh097. 32 Baza danych

Reid AJ, Yeats C, Orengo CA: Metody zdalnego wykrywania homologii można łączyć, aby zwiększyć pokrycie o 10% w strefie północy. Bioinformatyka. 2007, 23: 2353-2360. 10.1093/bioinformatyka/btm355.

Apic G, Gough J, Teichmann SA: Kombinacje domen w proteomach archeonów, eukariotycznych i eukariotycznych. J Mol Biol. 2001, 310: 311-325. 10.1006/jmbi.2001.4776.

Marchler-Bauer A, Anderson JB, Derbyshire MK, DeWeese-Scott C, Gonzales NR, Gwadz M, Hao L, He S, Hurwitz DI, Jackson JD, Ke Z, Krylov D, Lanczycki CJ, Liebert CA, Liu C, Lu F, Lu S, Marchler GH, Mullokandov M, Song JS, Thanki N, Yamashita RA, Yin JJ, Zhang D, Bryant SH: CDD: zachowana baza danych domen do interaktywnej analizy rodziny domen. Kwasy nukleinowe Res. 2007, D237-D240. 10.1093/nar/gkl951. 35 Baza danych

Hulo N, Bairoch A, Bulliard V, Cerutti L, Cuche BA, de Castro E, Lachaize C, Langendijk-Genevaux PS, Sigrist CJ: 20 lat PROSITE. Kwasy nukleinowe Res. 2008, D245-D249. 36 Baza danych

Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz HR, Ceric G, Forslund K, Eddy SR, Sonnhammer EL, Bateman A: Baza danych rodzin białek Pfam. Kwasy nukleinowe Res. 2008, D281-D288. 36 Baza danych

Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P: SMART 5: domeny w kontekście genomów i sieci. Kwasy nukleinowe Res. 2006, D257-D260. 10.1093/nar/gkj079. 34 Baza danych

Uniwersalne źródło białka (UniProt). Kwasy nukleinowe Res. 2008, D190-D195. 36 Baza danych

Mulder NJ, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D, Bork P, Buillard V, Cerutti L, Copley R, Courcelle E, Das U, Daugherty L, Dibley M, Finn R, Fleischmann W, Gough J , Haft D, Hulo N, Hunter S, Kahn D, Kanapin A, Kejariwal A, Labarga A, Langendijk-Genevaux PS, Lonsdale D, Lopez R, Letunic I, Madera M, Maslen J, et al: Nowe zmiany w InterPro Baza danych. Kwasy nukleinowe Res. 2007, D224-D228. 10.1093/nar/gkl841. 35 Baza danych

Yeats C, Lees J, Reid A, Kellam P, Martin N, Liu X, Orengo C: Gene3D: kompleksowa strukturalna i funkcjonalna adnotacja genomów. Kwasy nukleinowe Res. 2008, D414-D418. 36 Baza danych

Wilson D, Madera M, Vogel C, Chothia C, Gough J: Baza danych SUPERFAMILY w 2007 r.: rodziny i funkcje. Kwasy nukleinowe Res. 2007, D308-D313. 10.1093/nar/gkl910. 35 Baza danych

Orengo CA, Michie AD, Jones S, Jones DT, Swindells MB, Thornton JM: CATH - hierarchiczna klasyfikacja struktur domen białkowych. Struktura. 1997, 5: 1093-1108. 10.1016/S0969-2126(97)00260-8.

Murzin AG, Brenner SE, Hubbard T, Chothia C: SCOP: strukturalna klasyfikacja bazy danych białek do badania sekwencji i struktur. J Mol Biol. 1995, 247: 536-540. 10.1006/jmbi.1995.0159.

Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, Smirnov S, Sverdlov AV, Vasudevan S, Wolf YI, Yin JJ, Natale DA : Baza danych COG: zaktualizowana wersja zawiera eukarionty. Bioinformatyka BMC. 2003, 4: 41-10.1186/1471-2105-4-41.

Kaplan N, Sasson O, Inbar U, Friedlich M, Fromer M, Fleischer H, Portugaly E, Linial N, Linial M: ProtoNet 4.0: hierarchiczna klasyfikacja jednego miliona sekwencji białkowych. Kwasy nukleinowe Res. 2005, D216-D218. 33 Baza danych

Petryszak R, Kretschmann E, Wieser D, Apweiler R: Moc predykcyjna bazy danych CluSTr. Bioinformatyka. 2005, 21: 3604-3609. 10.1093/bioinformatyka/bti542.

Krause A, Stoye J, Vingron M: Hierarchiczne grupowanie sekwencji białek na dużą skalę. Bioinformatyka BMC. 2005, 6: 15-10.1186/1471-2105-6-15.

Bru C, Courcelle E, Carrere S, Beausse Y, Dalmar S, Kahn D: Baza danych ProDom rodzin domen białkowych: większy nacisk na 3D. Kwasy nukleinowe Res. 2005, D212-D215. 33 Baza danych

Portugaly E, Linial N, Linial M: EVEREST: zbiór ewolucyjnie konserwowanych domen białkowych. Kwasy nukleinowe Res. 2007, D241-D246. 10.1093/nar/gkl850. 35 Baza danych

Watson JD, Sanderson S, Ezersky A, Savchenko A, Edwards A, Orengo C, Joachimiak A, Laskowski RA, Thornton JM: W kierunku w pełni zautomatyzowanego przewidywania funkcji opartej na strukturze w genomice strukturalnej: studium przypadku. J Mol Biol. 2007, 367: 1511-1522. 10.1016/j.jmb.2007.01.063.

Chothia C, Lesk AM: Związek między rozbieżnością sekwencji a strukturą białek. EMBO J. 1986, 5:823-826.

Taylor WR, Orengo CA: Wyrównanie struktury białka. J Mol Biol. 1989, 208: 1-22. 10.1016/0022-2836(89)90084-3.

Redfern OC, Harrison A, Dallman T, Pearl FM, Orengo CA: CATHEDRAL: szybki i skuteczny algorytm do przewidywania fałd i granic domen ze struktur białek wielodomenowych. PLoS Comput Biol. 2007, 3: e232-10.1371/journal.pcbi.0030232.

Holm L, Sander C: Porównanie struktury białek przez wyrównanie macierzy odległości. J Mol Biol. 1993, 233: 123-138. 10.1006/jmbi.1993.1489.

Krissinel E, Henrick K: Dopasowywanie struktury drugorzędowej (SSM), nowe narzędzie do szybkiego dopasowania struktury białek w trzech wymiarach. Acta Crystallogr D Biol Crystallogr. 2004, 60: 2256-2268. 10.1107/S0907444904026460.

Madej T, Gibrat JF, Bryant SH: Nawlekanie bazy danych rdzeni białkowych. Białka. 1995, 23: 356-369. 10.1002/prot.340230309.

Shindyalov IN, Bourne PE: Wyrównanie struktury białka przez przyrostowe rozszerzenie kombinatoryczne (CE) ścieżki optymalnej. Białko inż. 1998, 11: 739-747. 10.1093/białko/11.9.739.

Kolodny R, Koehl P, Levitt M: Kompleksowa ocena metod wyrównania struktury białek: punktacja za pomocą środków geometrycznych. J Mol Biol. 2005, 346: 1173-1188. 10.1016/j.jmb.2004.12.032.

Tak Y, Godzik A: Elastyczne dopasowanie struktury poprzez łączenie w łańcuchy ułożonych par fragmentów umożliwiających skręty. Bioinformatyka. 2003, 19 (Suppl 2): ​​ii246-255.

Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE: Bank danych białek. Kwasy nukleinowe Res. 2000, 28: 235-242. 10.1093/nar/28.1.35.

Polacco BJ, Babbitt PC: Zautomatyzowane odkrywanie motywów 3D do adnotacji funkcji białek. Bioinformatyka. 2006, 22:723-730. 10.1093/bioinformatyka/btk038.

Kleywegt GJ: Rozpoznawanie motywów przestrzennych w strukturach białkowych. J Mol Biol. 1999, 285: 1887-1897. 10.1006/jmbi.1998.2393.

Wangikar PP, Tendulkar AV, Ramya S, Mali DN, Sarawagi S: Miejsca funkcjonalne w rodzinach białek odkryte za pomocą obiektywnego i zautomatyzowanego podejścia opartego na teorii grafów. J Mol Biol. 2003, 326: 955-978. 10.1016/S0022-2836(02)01384-0.

Laskowski RA, Luscombe NM, Swindells MB, Thornton JM: Rozszczepy białek w rozpoznawaniu i funkcji molekularnej. Białko Sci. 1996, 5: 2438-2452.

Laskowski RA: SURFNET: program do wizualizacji powierzchni molekularnych, wnęk i oddziaływań międzycząsteczkowych. Wykres J Mola. 1995, 13:323-330. 10.1016/0263-7855(95)00073-9.

Landau M, Mayrose I, Rosenberg Y, Glaser F, Martz E, Pupko T, Ben-Tal N: ConSurf 2005: projekcja ewolucyjnych wyników zachowania pozostałości na strukturach białkowych. Kwasy nukleinowe Res. 2005, 33: W299-W302. 10.1093/nar/gki370.

Glaser F, Rosenberg Y, Kessel A, Pupko T, Ben-Tal N: Baza danych ConSurf-HSSP: mapowanie zachowania ewolucyjnego wśród homologów na struktury PDB. Białka. 2005, 58: 610-617. 10.1002/prot.20305.

Binkowski TA, Freeman P, Liang J: pvSOAR: wykrywanie podobnych wzorów powierzchni kieszeni i pustych powierzchni reszt aminokwasowych na białkach. Kwasy nukleinowe Res. 2004, 32: W555-W558. 10.1093/nar/gkh390.

Dundas J, Ouyang Z, Tseng J, Binkowski A, Turpaz Y, Liang J: CASTp: obliczony atlas topografii powierzchni białek ze strukturalnym i topograficznym mapowaniem funkcjonalnie adnotowanych reszt. Kwasy nukleinowe Res. 2006, 34: W116-W118. 10.1093/nar/gkl282.

Bagley SC, Altman RB: Charakterystyka mikrośrodowiska otaczającego miejsca białkowe. Białko Sci. 1995, 4: 622-635.

Shulman-Peleg A, Nussinov R, Wolfson HJ: SiteEngine: rozpoznawanie i porównanie miejsc wiążących i interfejsów białko-białko. Kwasy nukleinowe Res. 2005, 33: W337-W341. 10.1093/nar/gki482.

Sasin JM, Godzik A, Bujnicki JM: SURF UP! - klasyfikacja białek przez porównania powierzchni. J Biosci. 2007, 32: 97-100. 10.1007/s12038-007-0009-0.

Porter CT, Bartlett GJ, Thornton JM: The Catalytic Site Atlas: zasób miejsc katalitycznych i pozostałości zidentyfikowanych w enzymach przy użyciu danych strukturalnych. Kwasy nukleinowe Res. 2004, 32: D129-D133. 10.1093/nar/gkh028.

Ivanisenko VA, Pintus SS, Grigorovich DA, Kolchanov NA: PDBSiteScan: program do wyszukiwania miejsc aktywnych, wiążących i potranslacyjnych modyfikacji w strukturach 3D białek. Kwasy nukleinowe Res. 2004, 32: W549-W554. 10.1093/nar/gkh439.

Ivanisenko VA, Pintus SS, Grigorovich DA, Kolchanov NA: PDBSite: baza danych struktury 3D miejsc funkcjonalnych białek. Kwasy nukleinowe Res. 2005, 33: D183-D187. 10.1093/nar/gki105.

George RA, Spriggs RV, Bartlett GJ, Gutteridge A, MacArthur MW, Porter CT, Al-Lazikani B, Thornton JM, Swindells MB: Skuteczna adnotacja funkcji dzięki katalitycznej ochronie pozostałości. Proc Natl Acad Sci USA. 2005, 102: 12299-12304. 10.1073/pnas.0504833102.

Laskowski RA, Watson JD, Thornton JM: ProFunc: serwer do przewidywania funkcji białka ze struktury 3D. Kwasy nukleinowe Res. 2005, 33: W89-W93. 10.1093/nar/gki414.

Stark A, Russell RB: Adnotacja w trzech wymiarach. PINTS: Wzory w niehomologicznych strukturach trzeciorzędowych. Kwasy nukleinowe Res. 2003, 31: 3341-3344. 10.1093/nar/gkg506.

Lichtarge O, Bourne HR, Cohen FE: Ewolucyjna metoda śladowa definiuje powierzchnie wiążące wspólne dla rodzin białek. J Mol Biol. 1996, 257: 342-358. 10.1006/jmbi.1996.0167.

Kristensen DM, Ward RM, Lisewski AM, Erdin S, Chen BY, Fofanov VY, Kimmel M, Kavraki LE, Lichtarge O: Przewidywanie funkcji enzymu na podstawie szablonów 3D ewolucyjnie ważnych aminokwasów. Bioinformatyka BMC. 2008, 9: 17-10.1186/1471-2105-9-17.

Ward RM, Erdin S, Tran TA, Kristensen DM, Lisewski AM, Lichtarge O: Pozbywanie się proteomu strukturalnego poprzez wzajemne porównanie ważnych ewolucyjnie cech strukturalnych. PLo JEDEN. 2008, 3: e2136-10.1371/journal.pone.0002136.

Herrgard S, Cammer SA, Hoffman BT, Knutson S, Gallina M, Speir JA, Fetrow JS, Baxter SM: Przewidywanie szkodliwych efektów funkcjonalnych mutacji aminokwasów przy użyciu biblioteki deskryptorów funkcji opartych na strukturze. Białka. 2003, 53: 806-816. 10.1002/prot.10458.

Pal D, Eisenberg D: Wnioskowanie funkcji białka ze struktury białka. Struktura. 2005, 13: 121-130. 10.1016/j.str.2004.10.015.

Salwinski L, Miller CS, Smith AJ, Pettit FK, Bowie JU, Eisenberg D: The Database of Interacting Proteins: aktualizacja 2004. Kwasy nukleinowe Res. 2004, 32: D449-D451. 10.1093/nar/gkh086.

Friedberg I, Harder T, Godzik A: JAFA: meta-serwer adnotacji funkcji białka. Kwasy nukleinowe Res. 2006, 34: W379-W381. 10.1093/nar/gkl045.

von Mering C, Krause R, Snel B, Cornell M, Oliver SG, Fields S, Bork P: Ocena porównawcza zestawów danych na dużą skalę interakcji białko-białko. Natura. 2002, 417: 399-403. 10.1038/natura750.

Pagel P, Kovac S, Oesterheld M, Brauner B, Dunger-Kaltenbach I, Frishman G, Montrone C, Mark P, Stümpflen V, Mewes HW, Ruepp A, Frishman D: Baza danych interakcji białek ssaków MIPS. Bioinformatyka. 2005, 21: 832-834. 10.1093/bioinformatyka/bti115.

Hart GT, Ramani AK, Marcotte EM: Jak kompletne są obecne sieci interakcji drożdży i białek ludzkich?. Biol genomowy. 2006, 7: 120-10.1186/pl-2006-7-11-120.

Aloy P, Russell RB: Dziesięć tysięcy interakcji dla biologa molekularnego. Nat Biotechnol. 2004, 22: 1317-1321. 10.1038/nbt1018.

Finn RD, Marshall M, Bateman A: iPfam: wizualizacja interakcji białko-białko w PDB przy rozdzielczościach domen i aminokwasów. Bioinformatyka. 2005, 21: 410-412. 10.1093/bioinformatyka/bti011.

Stein A, Russell RB, Aloy P: 3did: oddziałujące domeny białkowe o znanej strukturze trójwymiarowej. Kwasy nukleinowe Res. 2005, 33: D413-D417. 10.1093/nar/gki037.

Riley R, Lee C, Sabatti C, Eisenberg D: Wnioskowanie interakcji domen białkowych z baz danych oddziałujących białek. Biol genomowy. 2005, 6: R89-10.1186/pl-2005-6-10-r89.

Jothi R, Cherukuri PF, Tasneem A, Przytycka TM: Koewolucyjna analiza domen w oddziałujących białkach ujawnia wgląd w interakcje domena-domena pośredniczące w interakcjach białko-białko. J Mol Biol. 2006, 362: 861-875. 10.1016/j.jmb.2006.07.072.

Pagel P, Wong P, Frishman D: Mapa interakcji domeny oparta na profilowaniu filogenetycznym. J Mol Biol. 2004, 344: 1331-1346. 10.1016/j.jmb.2004.10.019.

Pagel P, Oesterheld M, Tovstukhina O, Strack N, Stumpflen V, Frishman D: DIMA 2.0 — przewidywane i znane interakcje domen. Kwasy nukleinowe Res. 2008, D651-D655. 36 Baza danych

Raghavachari B, Tasneem A, Przytycka TM, Jothi R: DOMINE: baza danych interakcji domen białkowych. Kwasy nukleinowe Res. 2008, D656-D661. 36 Baza danych

Moult J, Pedersen JT, Judson R, Fidelis K: Eksperyment na dużą skalę w celu oceny metod przewidywania struktury białek. Białka. 1995, 23: ii-v. 10.1002/prot.340230303.

Soro S, Tramontano A: Przewidywanie funkcji białka w CASP6. Białka. 2005, 61 (Suplement 7): 201-213. 10.1002/prot.20738.

Pellegrini-Calace M, Soro S, Tramontano A: Powrót do przewidywania funkcji białka w CASP6. FEBS J. 2006, 273: 2977-2983. 10.1111/j.1742-4658.2006.05309.x.


6 definicji

Poniższe definicje powinny pomóc użytkownikowi w zrozumieniu tego, co jest nazwane, oraz w zrozumieniu zasad leżących u podstaw niniejszych wytycznych.

6.1 Gen

Gen to jednostka funkcjonalna, zwykle kodująca białko lub RNA, której dziedziczenie można prześledzić eksperymentalnie. Dziedziczenie jest zwykle oznaczane w krzyżówkach genetycznych, ale identyfikacja genu na mapach cytogenetycznych lub fizycznych to inne sposoby mapowania locus genu. Istnienie genu można również wywnioskować z braku jakiejkolwiek informacji genetycznej lub fizycznej mapy, takiej jak sekwencja cDNA.

6.2 Pseudogen

Sekwencja, która bardzo przypomina znany funkcjonalny gen w innym locus w genomie, który jest niefunkcjonalny w wyniku (zwykle kilku) mutacji, które uniemożliwiają transkrypcję lub translację (lub obie). Ogólnie rzecz biorąc, pseudogeny powstają albo w wyniku odwrotnej transkrypcji transkryptu ich „normalnego” paralogu (w którym to przypadku pseudogen zazwyczaj nie zawiera intronów i zawiera ogon poli(A), często nazywany przetworzonymi pseudogenami) albo w wyniku rekombinacji (w takim przypadku pseudogen jest zazwyczaj tandemowa kopia jego „normalnego” paralogu). Zauważ, że u myszy i szczura gen może być pseudogenem w jednym szczepie wsobnym, ale nie w innym.

6.3 Miejsce

Locus to punkt w genomie, identyfikowany za pomocą markera, który można zmapować za pomocą pewnych środków. Niekoniecznie odpowiada on genowi, może to być na przykład anonimowy niekodujący segment DNA lub cecha cytogenetyczna. Pojedynczy gen może mieć w sobie kilka loci (każdy określony przez różne markery), a markery te mogą być rozdzielone w eksperymentach mapowania genetycznego lub fizycznego. W takich przypadkach przydatne jest zdefiniowanie tych różnych loci, ale zwykle nazwa genu powinna być używana do oznaczenia samego genu, ponieważ zwykle przekaże ona najwięcej informacji.

6.4 Znacznik

Marker to środek, za pomocą którego identyfikuje się gen lub locus. Marker jest zależny od testu, którym może być na przykład identyfikacja zmutowanego fenotypu lub obecność aktywności enzymatycznej, prążka białkowego lub fragmentu DNA. Test musi wykazywać zmienność genetyczną markera, aby mapować locus na mapie genetycznej, ale nie umieszczać go na mapie fizycznej.

6.5 Allel

Dwie kopie autosomalnego genu lub locus na chromosomach matki i ojca są allelami. Jeśli te dwa allele są identyczne, zwierzę jest homozygotyczne w tym locus. Gdy genetycznie odziedziczone warianty genu lub locus są wykrywalne w dowolny sposób, różne allele umożliwiają mapowanie genetyczne. Pojedynczy chromosom może nieść tylko jeden allel i, z wyjątkiem przypadków duplikacji, delecji lub trisomii, zwierzę nosi dwa autosomalne allele. W szczególności transgen wstawiony losowo do genomu nie jest allelem endogennego locus, stan jest określany jako hemizygotyczny, jeśli transgen jest obecny tylko w jednym z dwóch zestawów chromosomów rodzicielskich. W przeciwieństwie do tego, gen zmodyfikowany przez celowanie w endogenny locus jest allelem i powinien być tak nazwany.

6.6 Wariant alleliczny

Warianty alleliczne są różnicami między allelami, wykrywalnymi dowolnym testem. Na przykład różnice w anonimowych sekwencjach DNA można wykryć jako prosty polimorfizm długości sekwencji (SSLP) lub polimorfizm pojedynczego nukleotydu (SNP). Inne typy wariantów obejmują różnice w masie cząsteczkowej lub ładunku białka, różnice w aktywności enzymatycznej lub różnice w konformacji jednoniciowej (SSCP). Wiele wariantów allelicznych, w szczególności wariantów DNA, nie nadaje zwierzęciu żadnego zewnętrznego fenotypu. Warianty te są często określane jako „polimorfizmy”, chociaż, ściśle mówiąc, termin ten dotyczy tylko wariantów o częstości występowania większej niż 1% w populacji.

6.7 Wariant splotu lub złącze alternatywne

Splicing alternatywny genu skutkuje różnymi, normalnie występującymi formami mRNA, zdefiniowanymi przez to, które eksony (lub części egzonów) są używane. Tak więc jeden lub więcej alternatywnych produktów białkowych może być wytwarzanych przez pojedynczy allel genu.Wśród różnych alleli alternatywne formy składania mogą się różnić lub nie, w zależności od tego, czy różnica sekwencji między allelami wpływa na normalny mechanizm składania i powoduje różnice w wykorzystaniu eksonu (lub częściowego egzonu). Na przykład, allel A może wytwarzać mRNA formy splotu 1, 2 i 3, podczas gdy allel B może wytwarzać mRNA formy splotu 1, 2 i 4, a allel C może wytwarzać mRNA formy splotu 1, 2 i 3. W tym W przypadku każdy z alleli A, B i C z definicji musi różnić się sekwencją DNA. Jednak różnica między allelem B a allelami A i C musi obejmować różnicę sekwencji, która wpływa na wzór splicingu genu.

6.8 Mutacja

Mutacja jest szczególną klasą wariantów alleli, która zwykle nadaje fenotypowo możliwą do zidentyfikowania różnicę do referencyjnego fenotypu „typu dzikiego”. Jednak w niektórych przypadkach, na przykład gdy rekombinacja homologiczna jest stosowana do celowania w gen, łatwo zidentyfikowany fenotyp może nie zostać uzyskany, nawet jeśli gen może stać się niefunkcjonalny. W takich przypadkach docelowe geny są jednak określane jako zmutowane allele.

6.9 Dominujący i recesywny

Dominujące i recesywne odnoszą się do natury dziedziczenia fenotypów, a nie do genów, alleli czy mutacji. Fenotyp recesywny to taki, który jest wykrywany tylko wtedy, gdy oba allele mają określony wariant lub mutację. Dominujący fenotyp jest wykrywalny, gdy obecny jest tylko jeden wariant allelu. Jeśli oba allele można jednocześnie wykryć w teście, to są one współdominujące. Na przykład test, który wykrywa zmienność DNA lub białka, prawie zawsze wykryje współdominujące dziedziczenie, ponieważ wykrywane są oba allele. Jeśli mutacja wytwarza fenotyp w heterozygocie, który jest pośredni między homozygotą normalną a zmutowaną, fenotyp jest określany jako półdominujący. Pojedyncza mutacja może nadawać zarówno fenotyp dominujący, jak i recesywny. Na przykład łatka myszy (Ph) mutacja ma heterozygotyczny (dominujący) fenotyp pigmentacji, ale także homozygotyczny (recesywny) fenotyp letalny. Ponieważ terminy odnoszą się do fenotypów, a nie do genów lub alleli, to w przypadku, gdy gen ma wiele zmutowanych alleli, każdy z nich może nadać fenotyp, który jest dominujący niektórym, ale recesywny innym, fenotypom ze względu na inne allele.

Penetrancja jest miarą ilościową tego, jak często fenotyp występuje w populacji, a ekspresja jest miarą tego, jak silnie fenotyp jest wyrażany u osobnika. Szczególnie w przypadku krzyżówek segregujących lub tam, gdzie występuje efekt progowy na manifestację fenotypową, pomiary te dostarczają dodatkowych sposobów na opisanie, w jaki sposób poszczególne kombinacje alleli prowadzą do fenotypu.

6.10 Genotyp

Genotyp to opis składu genetycznego zwierząt, zwykle pod kątem konkretnych alleli w poszczególnych loci. Może odnosić się do pojedynczych genów lub loci lub do wielu. Genotyp można określić jedynie poprzez badanie fenotypu, w tym kojarzenie testowe w celu wykrycia nosicieli mutacji recesywnych. Ściśle mówiąc, nawet bezpośrednie określenie wariantów DNA polega na ocenie fenotypu, a nie genotypu, ponieważ jest on zależny od konkretnego testu, chociaż jest tak blisko genotypu, że służy jako surogat.

6.11 Fenotyp

Fenotyp jest wynikiem interakcji między genotypem a środowiskiem i można go określić dowolnym testem.

6.12 Loci cech ilościowych (QTL)

Ilościowe loci cech (QTL) to polimorficzne loci zawierające allele, które w różny sposób wpływają na ekspresję cech fenotypowych o ciągłej dystrybucji. Zwykle są to markery opisane przez statystyczne powiązanie ze zmiennością ilościową w poszczególnych cechach fenotypowych, które są kontrolowane przez skumulowane działanie alleli w wielu loci.

6.13 Haplotyp

Haplotyp to połączenie genetycznie powiązanych alleli, które występują w gamecie. Mogą być kombinacją dowolnego rodzaju markerów i mogą rozciągać się na duże, genetycznie możliwe do oddzielenia odległości lub znajdować się w niewielkiej odległości, takiej jak w genie i normalnie nie są rozdzielone.

6.14 Homolog

Geny są homologiczne, jeśli w sposób rozpoznawalny wyewoluowały ze wspólnego przodka. Zauważ, że geny są albo homologiczne, albo nie, nie ma stopni homologii! Na przykład wszystkie geny globiny i mioglobina są homologami, chociaż niektóre są ze sobą bliżej spokrewnione niż inne. Gdy wymagana jest miara pokrewieństwa między sekwencjami, należy zastosować procent identyczności lub podobieństwa.

6.15 Ortolog

Geny w różnych gatunkach są ortologami, jeśli wyewoluowały z jednego wspólnego genu przodków. Na przykład geny beta globiny myszy, szczura i człowieka są ortologami. Zauważ, że kilka genów myszy lub szczura może mieć jeden ortolog u innego gatunku i na odwrót.

6.16 Paralog

Geny paralogiczne to geny tego samego gatunku, które powstały od wspólnego przodka w wyniku duplikacji i późniejszej dywergencji. Na przykład mysie geny alfa globiny i beta globiny są paralogami.


Struktura APOB Gen/APOB Edycja mRNA

U dorosłych ludzi apoB-100 jest produkowany w wątrobie (4536 aminokwasów 100%), a apoB-48 w jelicie (2152 aminokwasy 48%) w unikalnym procesie edycji mRNA (1). 43-kb APOB Gen znajduje się na krótkim ramieniu ludzkiego chromosomu 2. Składa się z 29 eksonów, z których ekson 26, mający 7572 pz, jest największy i koduje ponad połowę białka o pełnej długości. Nowatorski proces edycji potranskrypcyjnej zachodzący na mRNA o wielkości 14,5 kb prowadzi do wytwarzania apoB-48. W skrócie, specyficzna dla RNA deaminaza cytydynowa, kompleks katalityczny enzymatyczny 1 edytujący mRNA apoB (apobec-1), wiąże się i działa na cząsteczkę cytozyny w podstawie 6666 mRNA, tworząc uracyl, który prowadzi do glutaminy 2153 (CAA ) kodon przekształcany w kodon terminacji (UAA) (2). Apobec-1 jest wytwarzany tylko w komórkach nabłonka jelit u dorosłych ludzi. Jest to proces edycji, który określa izoformę apoB, która ma zostać zsyntetyzowana, co z kolei dyktuje rodzaj lipoproteiny, czy to chylomikronu, czy cząstki VLDL, która ma zostać złożona.


Rysunek 1

Rysunek 1. Schematyczne przedstawienie mutagenezy wysycającej ze skanowaniem miejsc (SSSM), mutagenezy ukierunkowanej wielomiejscowej (MSDM) i syntezy genów za pomocą przepływów pracy z dokładną syntezą opartą na PCR (PAS). (A, od lewej do prawej) Przepływ pracy SSSM: Dane wejściowe użytkownika obejmują sekwencję plazmidu (niebieski) z interesującym genem, listę pozycji aminokwasów do zmiany (czerwone kwadraty, tylko 3 miejsca są oznaczone dla uproszczenia), startery do przodu i do tyłu (Ffwd i Frev, fioletowe strzałki), zdegenerowany kodon (oznaczony jako „X”) oraz lista żądanych parametrów (Tm, zawartość GC, startery flankujące, itp., nie pokazany). Mutation Maker generuje pary starterów mutagennych (żółtych) nakładających się do przodu i do tyłu (żółte) dla wielu równoległych reakcji PCR na wielu 96-dołkowych płytkach (zielona strzałka). Aby utworzyć fragmenty genów N- i C-, reakcje PCR są najpierw przeprowadzane oddzielnie i równolegle dla każdego miejsca (odpowiednio górny i dolny rzędy) przy użyciu mutagennych (żółtych z czerwonymi kwadratami) i flankujących par starterów (fioletowy) oraz matrycy genu ( niebieski). Nakładające się fragmenty N- i C- są następnie łączone za pomocą flankujących starterów (fioletowy) przez druga reakcja PCR (SOEing, Splicing by Overlap Extension), która wytwarza warianty genów pełnej długości. Są one następnie łączone w celu utworzenia biblioteki genowej, w której każdy wariant niesie pojedynczą losową substytucję aminokwasową w określonej pozycji. Następnie bibliotekę klonuje się do wektora ekspresyjnego (niebieskie kółka). (B, od lewej do prawej) Przepływ pracy MSDM: Dane wejściowe użytkownika obejmują gen będący przedmiotem zainteresowania oraz listę docelowych reszt i mutacji (czerwone kwadraty, dla uproszczenia pokazano tylko 3 mutacje) oraz listę parametrów (Tm, GC, organizm gospodarza, degeneracja, itp., nie pokazany). Mutation Maker generuje zestaw jednokierunkowych starterów mutagennych (żółtych z czerwonymi kwadratami), a także starterów zawierających kodony rodzicielskie (jasnożółte kwadraty na starterach), które pokrywają jedno lub więcej miejsc docelowych. Uzyskane startery można stosować w eksperymentach MSDM przy użyciu zestawu QuikChange lightning multi-site-directed mutagenesis kit (Agilent) w celu uzyskania zróżnicowanej biblioteki kombinatorycznej (niebieskie kółka). (C, od lewej do prawej) De novo Przepływ pracy syntezy genów przy użyciu protokołu dokładnej syntezy opartej na PCR (PAS). Dane wejściowe do tworzenia mutacji składa się z interesującego genu (linia niebieska) z listą reszt docelowych i mutacji (czerwone kwadraty, jak wskazano), a także z listą ograniczeń (Tm, GC, organizm gospodarza, motywy do wykluczenia, degeneracja, itp., nie pokazany). Mutation Maker generuje zestaw nakładających się oligonukleotydów (żółtych), które mogą przenosić kombinacje mutacji i kodonów rodzicielskich (odpowiednio czerwone i jasnożółte kwadraty) w swoich nienakładających się częściach. Te oligonukleotydy można złożyć w warianty genów pełnej długości (linie niebieskie), z których każdy niesie różne kombinacje mutacji, które później można sklonować do wektora ekspresyjnego (niebieskie kółka).


Obejrzyj wideo: Translacja (Sierpień 2022).