Informacja

Pokonywanie depresji wsobnej

Pokonywanie depresji wsobnej


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Kiedy pojawia się depresja inbredowa, osobnik niespokrewniony genetycznie jest kojarzony ze zwierzęciem w celu wprowadzenia zmienności genetycznej i usunięcia homozygotyczności. W takim przypadku można przeprowadzić krzyżowanie lub krzyżowanie. Czy jest jakaś preferencja dla jednej techniki nad drugą? Krzyżowanie tutaj odnosi się do kojarzenia dwóch osobników tej samej rasy, ale nie ma niedawnych wspólnych przodków. Krzyżowanie odnosi się do kojarzenia całkowicie dwóch osobników różnych ras.


Depresję inbredową można przezwyciężyć następującymi sposobami: 1. Hodowla wsobna – chów zwierząt niespokrewnionych ze sobą i nie mających przodków przez 4-6 pokoleń 2. Krzyżowanie wsobne – dokonywane ze zwierzętami tej samej rasy, ale po 4-6 pokoleniach 3. Krzyżowanie – lepszy samiec skojarzony z wyższą samicą innej rasy 4. Międzygatunkowe krzyżówki – samiec i samica dwóch różnych spokrewnionych gatunków


Genetyczne podłoże depresji inbredowej u ziemniaka

Depresja inbredowa powoduje obniżoną sprawność u potomstwa krewnych genetycznych. Jako roślina rozmnażana przez klony, ziemniak (Solanum tuberosum L.) cierpi na poważną depresję inbredową, jednak genetyczna podstawa depresji inbredowej u ziemniaka jest w dużej mierze nieznana. Aby uzyskać wgląd w depresję inbredową u ziemniaka, oceniliśmy obciążenie mutacją w 151 diploidalnych ziemniakach i uzyskaliśmy 344 831 przewidywanych szkodliwych substytucji. Szkodliwe mutacje w ziemniaku są wzbogacone w regiony pericentromeryczne i są specyficzne dla linii. Używając trzech F2 populacjach zidentyfikowaliśmy 15 regionów genomowych z poważnymi zniekształceniami segregacji z powodu selekcji na etapach gamety i zygoty. Większość szkodliwych alleli recesywnych wpływających na przeżycie i żywotność wzrostu była zlokalizowana w regionach o wysokim współczynniku rekombinacji. Jeden z tych szkodliwych alleli pochodzi z rzadkiej mutacji, która niszczy gen niezbędny do rozwoju zarodka. Badanie to stanowi podstawę do projektowania genomu linii wsobnych ziemniaka.


Pokonywanie depresji wsobnej - biologia

W małej populacji kojarzenia między krewnymi są powszechne. Ten chów wsobny może obniżyć zdolność populacji do przetrwania i rozmnażania, zjawisko zwane depresją wsobną. Na przykład populacja 40 użytkowników (Vipera berus, pokazane po prawej) doświadczyły depresji inbredowej, gdy działalność rolnicza w Szwecji izolowała je od innych populacji adder. W populacji izolowanej urodził się większy odsetek potomstwa martwo urodzonego i zdeformowanego niż w populacjach większych. Kiedy badacze wprowadzili żmije z innych populacji – przykład krzyżowania – izolowana populacja wyzdrowiała i wyprodukowała wyższy odsetek żywotnego potomstwa.

Wyjaśnienie depresji inbredowej leży w ewolucyjnej historii populacji. Z biegiem czasu dobór naturalny usuwa szkodliwe allele z populacji, a gdy dominujące szkodliwe allele ulegają ekspresji, obniżają przystosowanie nosiciela i mniej kopii kończy się w następnym pokoleniu. Ale recesywne szkodliwe allele są „ukryte” przed doborem naturalnym przez ich dominujące, nieszkodliwe odpowiedniki. Osobnik niosący pojedynczy recesywny szkodliwy allel będzie zdrowy i może łatwo przekazać szkodliwy allel następnemu pokoleniu.

Gdy populacja jest duża, na ogół nie stanowi to problemu – populacja może nosić wiele recesywnych, szkodliwych alleli, ale rzadko ulegają one ekspresji. Jednak gdy populacja staje się mała, bliscy krewni łączą się ze sobą, a ci krewni prawdopodobnie są nosicielami To samo recesywne szkodliwe allele. Gdy krewni łączą się w pary, potomstwo może odziedziczyć dwa kopie tego samego recesywnego szkodliwego allelu i ponoszą konsekwencje ekspresji szkodliwego allelu, jak pokazano w poniższym przykładzie. W przypadku żmii szwedzkich oznaczało to martwe potomstwo i deformacje.

W przypadku żmij szwedzkich rozwiązaniem problemu depresji inbredowej było proste wprowadzenie żmij z innych populacji. Ale jeśli północny wombat włochaty cierpi na depresję inbredową, nie ma innych populacji, które mogłyby go uratować. Zrozumienie historii ewolucyjnej populacji i prawdopodobieństwa, że ​​nosi ona recesywne szkodliwe allele, sugeruje, że nie powinniśmy pozwalać na zbyt niski spadek liczebności populacji w naszych wysiłkach na rzecz ochrony, ponieważ depresja inbredowa może zagrozić przetrwaniu gatunku.


Negatywne aspekty praktyki hodowlanej

Nihar Ranjan Chattopadhyay, indukowana hodowla ryb, 2017 r.

5.3.12 Lokalne wymieranie w obliczu migracji

Depresja inbredowa jest zwykle redukowana przez imigrantów, którzy są heterozygotyczni pod względem szkodliwych mutacji recesywnych (Whitlock et al., 2000), a dzięki heterozji średnie dopasowanie populacji może być zwiększone. Jednak krzyżowanie może zmniejszyć średnią sprawność populacji, jeśli hybrydyzacja zaburza koadaptowane kompleksy genów lub korzystne interakcje epistatyczne (depresja krzyżowa). Niewiele badań wykazało krzyżowanie depresji, ponieważ wymaga śledzenia poza F1 pokolenie. Badanie wróbli śpiewających (Marr i in., 2002) wykazało oznaki depresji krzyżowej w F2 generacji, a miary sprawności były niskie w okresie F2 generacja krzyży widłonoga pływowego (Tygrys kalifornijski) z różnych populacji (Burton, 1990). Jednak ten efekt rozpadu koadaptacji jest spotęgowany tylko wtedy, gdy dystans genetyczny między dwiema populacjami znacznie się zwiększył (Edmands, 1999). Tak więc zagrożenie krzyżowania się wsobów może nie być bardzo poważne w większości dzikich populacji, ponieważ potrzeba wielu pokoleń w kontrastowych środowiskach, aby dystans genetyczny był znacząco duży.

Zmniejszenie lub zwiększenie sprawności w populacji po przyjęciu imigrantów zależy również od interakcji między kilkoma czynnikami genetycznymi i niegenetycznymi (stopień epistazy, demografia, zachowanie, środowisko itp. Tallmon i in., 2004 ). Dlatego może być trudno przewidzieć, czy dane wydarzenie imigracyjne wpłynie na ratunek genetyczny, zwłaszcza gdy zarządzający ochroną przyrody nie rozumieją interakcji między czynnikami genetycznymi i niegenetycznymi. Jednak Gaggiotti (2003) dokonał przeglądu badań dotyczących roślin, takich jak Skopariusz lotosu, Ipomopsis agregacja, oraz Silene diclinis i doszli do wniosku, że depresja krzyżowa może być powszechna w środowisku naturalnym, ale potencjalne korzyści z krzyżowania krzyżowego zwykle przewyższają zagrożenia depresji krzyżowej.


WALKI

Wszystkie zalecenia, które zostały poczynione w poprzednim rozdziale, opierały się na utrzymaniu minimalnej stałej Nmi's. Niestety trudno jest utrzymać stałą wartość Nmi pokolenie po pokoleniu. Każdy, kto kiedykolwiek zarządzał populacją ryb, wie aż za dobrze, że trudno jest utrzymać populację w stanie równowagi. Wiele czynników skłania się do od czasu do czasu zmniejszania liczebności populacji. Nagłe drastyczne spadki liczebności populacji nazywane są „wąskimi gardłami”. Skutki genetyczne wąskich gardeł mogą być niszczące i mogą mieć długoterminowe reperkusje.

Jak opisano w rozdziale 4, średnia Nmi w ciągu serii pokoleń jest średnią harmoniczną, a nie prostą średnią arytmetyczną. W konsekwencji generacja o najmniejszym Nmi ma nieproporcjonalny wpływ na wartość średnią. Oznacza to, że wąskie gardło może znacznie obniżyć średnią Nmi, co z kolei dramatycznie zwiększy chów wsobny i dryf genetyczny.

Na przykład, jeśli rolnik chce utrzymać stałą wartość Nmi 100 dla 10 pokoleń, ale występuje wąskie gardło 20 w generacji 6, średnia Nmi które wyprodukował to:

nto znaczy można określić za pomocą przycisku &bdquo1/x&rdquo na ręcznym kalkulatorze.

Średnia arytmetyczna dla tego szeregu Nmito 92, więc znaczy Nmi jest o 22% mniejsza niż można by się spodziewać. Gdyby istniały dwa wąskie gardła po 20, średnia Nmi spadłby do zaledwie 55,6.

Wąskie gardła mogą mieć poważny i długotrwały wpływ na chów wsobny, ponieważ po wystąpieniu chowu wsobnego obniża on przyszłe NmiJak opisano w rozdziale 4. Wpływ wąskich gardeł na przeciętną chów wsobny zależy od wielkości wąskich gardeł i ich liczby. Populacja, która jest źle zarządzana i doświadcza wielu wąskich gardeł, gdzie populacja jest zredukowana do stosunkowo niewielkiej liczby samców i/lub samic, będzie dość wsobna. Z drugiej strony, dobrze zarządzana populacja, która doświadcza pojedynczego wąskiego gardła, będzie znacznie mniej dotknięta. Pojedyncze wąskie gardło spowoduje natychmiastowy wzrost chowu wsobnego, a średni chów wsobny może wzrosnąć o jedno lub dwa pokolenie (ilość zależy od wielkości wąskiego gardła), ale jeśli populacja jest odpowiednio zarządzana, aby zminimalizować chów wsobny przed i po wąskim gardle, przeciętny chów wsobny ustabilizuje się kilka pokoleń po wąskim gardle, a szkody wynikające z chowu wsobnego mogą nie być poważne.

Rysunek 32. Wpływ wąskich gardeł na częstotliwość genów. Ponieważ dryf genetyczny i prawdopodobieństwo utraty alleli są odwrotnie proporcjonalne do efektywnej liczby hodowlanej (Nmi), wielkość wąskiego gardła determinuje wielkość zmiany genetycznej. Częstotliwości A oraz a allele w populacji wynoszą zarówno 0,5. Jako wąskie gardło (Nmi) staje się mniejszy, dryf genetyczny zmienia częstotliwość genów, aż w skrajnym przypadku częstotliwość allelu spada do zera.

Wpływ wąskich gardeł na dryf genetyczny jest znacznie bardziej niszczycielski. Prawdopodobieństwo utraty allelu jest odwrotnie proporcjonalne do Nmi, więc szanse na utratę allelu rosną jako Nmi zmniejsza się. Wąskie gardła dramatycznie zwiększają prawdopodobieństwo. Wpływ, jaki wąskie gardło może mieć na częstotliwość występowania genów, zilustrowano na rysunku 32.

Na przykład, jeśli rolnik stara się utrzymać stałą wartość Nmi 344 na 10 pokoleń w celu uzyskania gwarancji 99% utrzymania allelu o częstości 0,01 (Tabela 5) i wąskim gardłem 25 w pokoleniu 8, prawdopodobieństwo utraty allelu przy wyprodukowaniu 10 pokolenia wynosi ustalana w następujący sposób:

Krok 1. Należy określić prawdopodobieństwo utraty allelu w każdym pokoleniu.

Krok 2. Należy określić gwarancję utrzymania allelu w każdym pokoleniu (1,0 – prawdopodobieństwo utraty allelu).

Prawdopodobieństwo utraty allelu i gwarancje zachowania allelu dla wszystkich 10 pokoleń to:

nmiKrok 1: Prawdopodobieństwo utraty alleluKrok 2: Gwarancja utrzymania alleli
(P = (1,0 - q) 2Nmi )(1,0 - P)
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852
25 P = (0,99) 2(25) = 0.6050060670.394993932
344 P = (0,99) 2(344) = 0.00099314770.999006852
344 P = (0,99) 2(344) = 0.00099314770.999006852

Krok 3. Należy określić gwarancję utrzymania allelu przez 10 pokoleń. Jest to iloczyn gwarancji zachowania allelu dla każdego pokolenia, tj. gwarancje dla każdego pokolenia są mnożone w celu określenia gwarancji po wyprodukowaniu 10. generacji:

Gwarancja po 10 pokoleniach=(0.999006852)(0.999006852)(0.999006852)(0.999006852)
(0.999006852)(0.999006852)(0.999006852)(0.394993932)
(0.999006852)(0.999006852)
Gwarancja po 10 pokoleniach=0.3915

Krok 4. Należy określić prawdopodobieństwo utraty allelu po 10 pokoleniach. To 1,0 - gwarancja zachowania allelu:

Prawdopodobieństwo utraty allelu = 1,0 - Gwarancja zachowania allelu

Prawdopodobieństwo utraty allelu = 1,0 - 0,3915

Prawdopodobieństwo utraty allelu = 0,6085

Wąskie gardło 25 w ósmej generacji zwiększało prawdopodobieństwo utraty allelu w 10. pokoleniu z 0,01 (co było celem) do 0,6085.

Ogólny wpływ pojedynczego wąskiego gardła na dryf genetyczny jest znacznie bardziej dotkliwy niż przeciętny chów wsobny, a jego wystąpienie może uniemożliwić rolnikowi lub kierownikowi wylęgarni osiągnięcie swoich celów, nawet jeśli wykonywał znakomitą pracę przez wiele pokoleń. Dzieje się tak, ponieważ utracony allel może zostać odzyskany tylko poprzez mutację lub wprowadzenie nowego stada lęgowego. W związku z tym zapobieganie wąskim gardłom powinno być głównym celem zarządzania stadem lęgowym, jeśli celem genetycznym jest zminimalizowanie szkodliwych skutków chowu wsobnego i dryfu genetycznego.


Kiedy zagrożona przyroda zostaje wsobna

Zagrożone populacje goryli nizinnych wschodnich są teraz tak małe, że gatunek ten stoi w obliczu nowego zagrożenia: utraty różnorodności genetycznej.

Goryle nie mogą złapać przerwy. Populacje, nękane utratą siedlisk, kłusownictwem, niestabilnością polityczną i innymi zagrożeniami, gwałtownie spadły. Teraz izolowane w małych populacjach, niektóre goryle nizinne wschodnie stoją w obliczu nowego zagrożenia: utraty różnorodności genetycznej. Gdy populacja się kurczy, pula genów często również się kurczy. Jeśli spadek jest wystarczająco duży, chów wsobny może nawet zagrozić przetrwaniu gatunku.

Spadek zdolności populacji do przetrwania poprzez chów wsobny nazywa się depresją wsobną. Ale jak omówili biolodzy Philip Hedrick i Steven Kalinowski w: Przeglądy roczne, depresja inbredowa przybiera różne formy w różnych okolicznościach. Jego wpływ na przeżycie nie jest łatwy do uogólnienia. W przypadku długowiecznych gatunków, takich jak goryle, ogólne skutki chowu wsobnego mogą ujawnić się przez dziesięciolecia i są trudne do zbadania.

Chów wsobny jest często badany w laboratorium przy użyciu organizmów takich jak Drosophila (muchy owocowe), gdzie niewielka populacja może być hodowana i badana przez wiele pokoleń. W takich badaniach, wraz ze wzrostem chowu wsobnego, szkodliwe mutacje zazwyczaj stają się coraz bardziej skoncentrowane w populacji w procesie zwanym demaskowaniem, co zagraża ogólnej sprawności populacji. W miarę jak populacja staje się coraz mniejsza i bardziej zrośnięta, szkodliwe uwarunkowania genetyczne stają się coraz bardziej powszechne.

Oczywiście geny nie działają w izolacji. Kluczowe znaczenie ma interakcja między genami a środowiskiem. W niektórych przypadkach może to sprawić, że depresja inbredowa stanie się kwestią sporną dla zagrożonych gatunków, ponieważ zagrożenia zewnętrzne, takie jak utrata siedlisk, mogą grozić wyginięciem, zanim depresja inbredowa będzie miała zbyt duże żniwo. Niestety bardzo zagrożone gatunki często żyją w stresujących środowiskach. Innymi słowy, ich sytuacja w świecie rzeczywistym może być gorsza niż przewidują modele, a populacje wsobne mają jeszcze mniejsze prawdopodobieństwo przeżycia niż populacje zdrowe.

Co więcej, mała populacja gatunku na wolności nie jest tym samym, co sztucznie mała populacja w laboratorium. Na przykład laboratoryjna populacja Drosophila jest próbką całej ogromnej dostępnej różnorodności genetycznej Drosophila. W przypadku rzeczywiście małej, zagrożonej populacji ogólna różnorodność genetyczna jest niska i jakakolwiek różnorodność genetyczna występuje w zredukowanej populacji, to wszystko, co istnieje, jest to sytuacja nazywana wąskim gardłem. Czasami to sprawia, że ​​niebezpieczne mutacje są powszechne – a to może bezpośrednio grozić wyginięciem.

Pobierz nasz biuletyn

Każdy gen ma różne warianty, zwane allelami, które powstają w wyniku mutacji. Jeden allel genu może przynieść korzyść, ale inny allel tego samego genu może wyrządzić szkodę. W wąskim gardle większość różnych alleli, w tym te szkodliwe, jest rzadkością. Czasami śmiertelny allel zostaje zdemaskowany i manifestuje się w osobniku, zabijając go lub uniemożliwiając reprodukcję. Ponieważ szkodliwy allel jest rzadkością, wynik ten usuwa te szkodliwe allele z populacji. W takich przypadkach chów wsobny przyspiesza utratę niebezpiecznych alleli, co może przynajmniej chwilowo być korzystne. Z drugiej strony, allele, które są szkodliwe, ale nie niszczące, łatwo utrwalają się w małych populacjach, podstępnie zmniejszając z czasem przystosowanie.

Dobrą wiadomością jest to, że czasami chów wsobny można złagodzić lub nawet odwrócić przez staranne wprowadzenie genów. Może to oznaczać ponowne wprowadzenie osobników wyhodowanych w niewoli lub selektywny transfer między odizolowanymi grupami. Takie działania same w sobie wiążą się z ryzykiem, ale jeśli chów wsobny jest wystarczająco straszny, konieczne mogą być drastyczne działania.


Wyniki

Genotypowanie i imputacja

Wszystkim badanym osobnikom poddano genotypowanie na urządzeniu Illumina Ovine SNP50 BeadChip, oznaczając 51 135 SNP. Ponadto 189 osób zostało genotypowanych na chipie Ovine Infinium High-Density zawierającym 606066 SNP. Aby zwiększyć rozdzielczość genomową dla naszych analiz, połączyliśmy autosomalne genotypy z obu chipów SNP z informacjami o rodowodach, aby przypisać brakujące SNP u osób genotypowanych przy niższej gęstości markerów za pomocą AlphaImpute56. Weryfikacja krzyżowa wykazała, że ​​imputacja była skuteczna, z medianą 99,3% prawidłowo przypisanych genotypów na osobę (tabela uzupełniająca 1). Ponadto wywnioskowane współczynniki inbredu FROH były bardzo podobne przy porównywaniu osobników genotypowanych na chipie o dużej gęstości (mediana FROH = 0,239) oraz osoby z przypisanymi SNP (mediana FROH = 0,241), co wskazuje na brak oczywistego błędu w obfitości wywnioskowanego ROH na podstawie danych imputowanych (ryc. uzupełniający 1). Po kontroli jakości zestaw danych genomowych zawierał 417 373 polimorficzne i autosomalne SNP ze średnią częstotliwością mniejszych alleli (MAF) 23% (ryc. uzupełniająca 2) i średnim odsetkiem wywołań 99,5% wśród osób.

Wzory chowu wsobnego w genomie

Najpierw zbadaliśmy, w jaki sposób chów wsobny i długoterminowa mała populacja (szacunkowa) nmi = 194 57 )-kształtne wzory ROH u owiec Soay (ryc. 1). Osoby miały średnio 194 ROH (sd = 11,6) dłuższe niż 1,2 Mb, co stanowiło średnio 24% genomu autosomalnego (tj. średnia FROH = 0,24, zakres = 0,18–0,50, rys. uzupełniający 3). Średni indywidualny współczynnik inbredu FROH owiec urodzonych w danym roku utrzymywało się na stałym poziomie w okresie badawczym (ryc. uzupełniający 4). Wśród osobniczych zmienność długości ROH była wysoka: średni ROH u siedmiu najbardziej zinbredowanych owiec był ponad dwukrotnie dłuższy niż ROH u siedmiu najmniej zinbredowanych owiec (odpowiednio 6,83 vs 2,72 Mb, Rys. 1a), chociaż średnia liczba ROH była podobna (odpowiednio 170 vs 169).

a ROH dłuższy niż 5 Mb u siedmiu osobników o najwyższych współczynnikach chowu wsobnego FROH w siedmiu górnych rzędach i siedmiu osobnikach z najniższym FROH w siedmiu dolnych rzędach. b Rozkład ROH pomiędzy różnymi klasami długości. Każdy punkt danych reprezentuje proporcję ROH określonej klasy długości w obrębie autosomalnego genomu danej osoby. Klasy długości ROH zostały podzielone na kategorie według ich oczekiwanej średniej długości fizycznej, gdy podstawowe haplotypy miały najnowszego wspólnego przodka (MRCA) 2-32 pokolenia (g) temu. C Gęstość ROH w całym genomie wśród wszystkich 5952 osobników w nienakładających się oknach 500 Kb. Gradient kolorów został przeskalowany zgodnie z gęstością ROH, co pokazano w legendzie rysunku.

Liczebność ROH u owiec Soay również różniła się znacznie między klasami długości ROH (ryc. 1b). Największa frakcja IBD w populacji składała się z ROH między 2,4 a 4,9 Mb pochodzącego około 8-16 pokoleń temu, co stanowiło średnio 8,1% genomu osobnika. Długie ROH > 19,5 Mb stwierdzono u 38,2% osobników (ryc. 1b). Jednak długi ROH stanowił średnio tylko 0,6% genomu najmniej zinbredowanych osobników z rodowodem chowu wsobnego Fpedi <0,1. W przeciwieństwie do tego, długi ROH rozciągał się na 7% i 18% genomu u osobników wsobnych z Fpedi > 0,1 i Fpedi >0,2, odpowiednio (rysunek uzupełniający 5).

Częstość występowania ROH w populacji była bardzo zróżnicowana w całym genomie (ryc. 1c). Przeskanowaliśmy ROH w nienakładających się oknach 500 Kb i sklasyfikowaliśmy okna 0,5% o najwyższej gęstości ROH jako wyspy ROH, a okna 0,5% o najniższej gęstości ROH jako pustynie ROH 31 . Górna wyspa ROH na chromosomie 1 (227–227,5 Mb) zawierała ROH u 87% osób, podczas gdy tylko 4,4% osób miało ROH na górnej pustyni ROH na chromosomie 11 (58,5–59 Mb, patrz tabela uzupełniająca 2 dla lista najlepszych pustyń i wysp ROH).

Gęstość ROH i szybkość rekombinacji

Szerokie zróżnicowanie gęstości ROH wzdłuż genomu można częściowo wyjaśnić rekombinacją, ponieważ regiony o wysokim tempie rekombinacji wytwarzają krótsze ROH, a ich wykrycie jest mniej prawdopodobne przez algorytmy wywołujące ROH30. Warto zauważyć, że sama rekombinacja nie wpływa na leżącą u podstaw rzeczywistą proporcję IBD, a jedynie wpływa na rozkład długości ROH. W związku z tym regiony o wysokiej rekombinacji mogą tworzyć domniemane pustynie ROH bez zmiany rzeczywistych poziomów IBD, ponieważ krótkie ROH są rzadziej nazywane 30 . Aby ocenić, jak duża zmienność gęstości ROH wzdłuż genomu wynika ze zmienności szybkości rekombinacji, a ile z nich śledzi podstawowe poziomy IBD, skonstruowaliśmy liniowy model mieszany z gęstością ROH (proporcją osób z ROH) mierzoną w 500 Kb okienka jako zmienna odpowiedzi, współczynnik rekombinacji okienka w cM/Mb w oparciu o mapę sprzężeń owiec Soay 58 i heterozygotyczność okienka SNP jako efekty stałe, jak również identyfikator chromosomu jako efekt losowy.

Szybkość rekombinacji i heterozygotyczność razem wyjaśniają 42% zmienności gęstości ROH (marginalna r 2 = 0,42, 95% CI [0,40, 0,44], tabela uzupełniająca 3A), przy czym większość zmienności wyjaśnia heterozygotyczność (półczęściowa r 2 = 0,38, 95% CI [0,36, 0,40], ryc. 2b) i tylko około 4% wyjaśnione współczynnikiem rekombinacji (częściowo r 2 = 0,04, 95% CI [0,02, 0,07], Ryc. 2a i Uzupełniająca Ryc. 6 dla wykresu chromosomowego). Wzorzec jest podobny w przypadku ponownego uruchomienia modelu tylko na oknach zidentyfikowanych jako wyspy ROH i pustynie, gdzie gęstość ROH jest w dużej mierze wyjaśniona heterozygotycznością (półczęściową r 2 = 0,89, 95% CI [0,83, 0,94], ryc. 2d), przy czym tylko niewielka część zmienności wyjaśnia zmienność szybkości rekombinacji (półczęściowa r 2 = 0,07, 95% CI [0,01, 0,12], Ryc. 2c). W konsekwencji, chociaż szybkość rekombinacji wpływa na długość ROH, a tym samym na prawdopodobieństwo wykrycia ROH, stanowi to tylko niewielką część zmienności wykrytej gęstości ROH, która w większości odzwierciedla podstawowe wzorce IBD wzdłuż genomu.

Przebiegi gęstości homozygotyczności (ROH), szybkości rekombinacji i heterozygotyczności oznaczono ilościowo w nienakładających się oknach 500 Kb, przy czym każdy punkt reprezentuje jedno okno. Górne 0,5% okien o największej i najniższej gęstości ROH w populacji, zwane wyspami ROH (n = 24) i desery (n = 24), są zabarwione odpowiednio na fioletowo i żółto na wszystkich czterech poletkach. a Związek między gęstością ROH a szybkością rekombinacji. b Związek gęstości ROH i heterozygotyczności SNP. C Szybkość rekombinacji na wyspach i pustyniach ROH. D Heterozygotyczność w obrębie wysp i pustyń ROH. Linie ciągłe w a i b to linie regresji liniowej i linie przerywane w C oraz D są środkami obejmującymi cały genom. Wykresy pudełkowe pokazują medianę jako linię środkową z granicami pudełka jako 25. i 75. percentyl, a górne i dolne wąsy jako największą i najmniejszą wartość, ale nie dalej niż 1,5 * zakres międzykwartylowy od zawiasu. Dane źródłowe dla tej figury są również dostarczane jako plik danych źródłowych.

Na koniec zbadaliśmy, jak duże różnice w gęstości ROH można wyjaśnić rekombinacją przy użyciu różnych minimalnych progów ROH. Powtórzyliśmy analizę z zestawem danych opartym na progu minimalnej długości ROH wynoszącym 0,4 Mb i drugim zestawem danych o minimalnej długości ROH wynoszącej 3 Mb (tabela uzupełniająca 3B, C). W porównaniu z oryginalnym zbiorem danych o minimalnej długości ROH wynoszącej 1,2 Mb, rekombinacja wyjaśniła mniejszą zmienność gęstości ROH w zbiorze danych, w tym krótszy ROH (półczęściowy r 2 = 0,01, 95% CI [0,00, 0,04]) i większa zmienność w zbiorze danych składającym się tylko z dłuższego ROH (półczęściowa r 2 = 0,08, 95% CI [0,06, 0,11]). W konsekwencji zmienność szybkości rekombinacji ma większy wpływ na wykrytą obfitość dłuższego ROH w całym genomie.

Depresja inbredowa a przeżycie

Przetrwanie jest kluczowym elementem fitnessu. W przypadku owiec sojowych ponad połowa wszystkich osobników umiera podczas pierwszej zimy, co minimalizuje ich szanse na rozmnażanie (rysunek uzupełniający 7). Przeżywalność owiec ocenia się poprzez rutynowe kontrole śmiertelności przeprowadzane przez cały rok. Ponad 80% owiec na badanym obszarze znajduje się po ich śmierci 50 , co daje łącznie 15 889 rocznych obserwacji przeżycia 5952 owiec. Rozkład poszczególnych współczynników inbredu FROH w różnych klasach wiekowych ujawniły, że osoby silnie zinbredowane rzadko przeżywają wczesne lata życia i nigdy nie osiągają starości (ryc. 3a). Jednak siła depresji inbredowej wydawała się zmniejszać w starszym wieku (ryc. 3b). Na przykład u owiec starszych niż cztery lata odsetek ocalałych wśród osobników najbardziej zinbredowanych był tylko nieznacznie niższy niż wśród osobników najmniej zinbredowanych (ryc. 3b).

a Rozkłady współczynników inbredu FROH w klasach wiekowych owiec Soay od 0 do 9 lat. b Odsetek osobników, które przeżyły rocznie w czterech różnych fazach życia i wśród różnych FROH zajęcia. Ponieważ osobniki wysoko zinbredowane są stosunkowo rzadkie, ostatnia klasa obejmuje szerszy zakres współczynników inbredu. Dane źródłowe dla tej figury są również dostarczane jako plik danych źródłowych. C Przewidywane prawdopodobieństwo przeżycia i 95% wiarygodne przedziały w zakresie współczynników inbredu FROH dla każdego etapu życia, utrzymując płeć i bliźniak na stałym poziomie 1 (mężczyzna) i 0 (brak bliźniaka). Prognozy dla późniejszych klas etapów życia wykraczają poza zakres danych, ale są pokazane w pełnym zakresie dla porównywalności.

Modelowaliśmy siłę depresji inbredowej przez całe życie za pomocą modelu zwierzęcego z dwumianowym rozkładem błędu i rocznym przeżyciem jako zmienną odpowiedzi. Ogólnie rzecz biorąc, wpływ chowu wsobnego na przeżywalność był silny: u jagniąt (wiek 0) 10% wzrost FROH było związane z multiplikatywną zmianą szans przeżycia o 0,4 (iloraz szans, OR [95% przedział wiarygodny, CI] = 0,40 [0,30; 0,53], tabela uzupełniająca 4) lub 60% zmniejszeniem (1–0,40) szanse na przeżycie. Przekłada się to na nieliniowe różnice przeżycia w skali prawdopodobieństwa. Na przykład samiec jagnięciny niebliźniaczej owcy Soay z FROH 10% powyżej średniej miało o 23% mniejsze prawdopodobieństwo przeżycia pierwszej zimy w porównaniu do przeciętnej jagnięciny (FROH = 0,34 vs FROH = 0,24 Rys. 3c). W całym okresie życia model szacuje interakcje między FROH a różne etapy życia przewidziały zmniejszenie nasilenia depresji inbredowej w późniejszych etapach życia (ryc. 3c) z największą przewidywaną różnicą między wczesnym (wiek 1, 2) i późnym (wiek 5+, OR [95% CI) ] = 2,03 [1,08, 3,82], tabela uzupełniająca 4).

Następnie oszacowaliśmy obciążenie inbredowe u owiec Soay jako diploidalną liczbę ekwiwalentów śmiercionośnych 2B. Ekwiwalenty śmiercionośne to pojęcie zakorzenione w genetyce populacyjnej, gdzie jeden śmiertelny ekwiwalent jest równy grupie mutacji, które w przypadku rozproszenia wśród osobników spowodowałyby średnio jedną śmierć 59 . Postępowaliśmy zgodnie z sugestiami Nietlisbacha i in. 60 i ponownie wyposażyliśmy model przeżycia w rozkład Poissona i logarytmiczną funkcję łącza, stosując uproszczoną strukturę modelu bez interakcji w celu lepszej porównywalności między badaniami. Dało to oszacowanie 2B = 4,57 (95% CI 2,61–6,55) śmiertelne ekwiwalenty dla rocznego przeżycia owiec Soay.

Architektura genetyczna depresji inbredowej

Aby określić ilościowo konsekwencje przeżycia IBD w każdej lokalizacji SNP, wykorzystaliśmy zmodyfikowane badanie asocjacyjne całego genomu (GWAS). W przeciwieństwie do tradycyjnego GWAS, gdzie PInteresujące są wartości addytywnego wpływu SNP, przeanalizowaliśmy wpływ statusu ROH dla obu alleli przy każdym SNP. W szczególności, w locus dialelicznym, ROH wynika albo z dwóch haplotypów IBD zawierających allel A, albo z dwóch haplotypów IBD zawierających allel B. Jeśli w populacji istnieją silnie szkodliwe allele recesywne, mogą one być związane z ROH na podstawie haplotypów alleli A lub na podstawie ROH na haplotypach alleli B. Aby to przetestować, skonstruowaliśmy dwumianowy mieszany model rocznego przeżycia dla każdej pozycji SNP. W każdym modelu dopasowaliśmy dwa predyktory stanu ROH. Pierwszemu predyktorowi przypisano 1, jeśli allel A był homozygotyczny i był częścią ROH, a 0 w przeciwnym razie. Drugiemu predyktorowi przypisano 1, jeśli allel B był homozygotyczny i był częścią ROH, a 0 w przeciwnym razie. Szacunki modelu i P-wartości dla tych dwóch predyktorów odzwierciedlają zatem, czy ROH są związane z konsekwencjami przeżycia w każdej lokalizacji SNP i dla każdego allelu. W modelu GWAS skontrolowaliśmy również addytywny efekt SNP i średnią inbredu indywidualnego FROH (na podstawie wszystkich autosomów z wyjątkiem chromosomu ogniskowego), wraz z szeregiem innych indywidualnych cech i skutków środowiskowych (szczegóły w sekcji „Metody”).

GWAS na allelicznym statusie ROH może wykryć szkodliwe allele recesywne w określonych regionach, gdy efekty ROH osiągają znaczenie dla całego genomu. Co więcej, rozkład efektów statusu ROH w całym genomie może również informować o ogólnej liczbie szkodliwych alleli recesywnych przyczyniających się do depresji inbredowej poprzez ROH. Zgodnie z hipotezą zerową, że status ROH nie ma wpływu na przeżycie w żadnej pozycji SNP, spodziewalibyśmy się rozkładu 50/50 negatywnych i pozytywnych oszacowań statusu ROH ze względu na przypadek. W przeciwieństwie do tego, stwierdziliśmy o wiele więcej negatywnych niż pozytywnych skutków statusu ROH na przeżycie w całym genomie niż oczekiwano przypadkowo (ryc. 4a, b 465 K neg. vs. 354 K poz. dokładny test dwumianowy P = 2,2 * 10-16). Co więcej, proporcja negatywnych efektów ROH wzrasta dla większych oszacowań modelu (rys. 4a) i mniejszych Pwartości (rys. 4b). Przetestowaliśmy to statystycznie przy użyciu dwóch dwumianowych uogólnionych modeli liniowych (GLM), z kierunkiem efektu jako odpowiedzią binarną oraz oszacowaniem modelu i P-value, odpowiednio, jako predyktory. Efekty ROH były bardziej prawdopodobne, gdy ich oszacowanie modelu było większe (log-OR [95% CI] = 0,35 [0,344, 0,358]) i gdy ich P-wartość była mniejsza (log-OR [95% CI] = −3,82 [−3,84, −3,80]). W konsekwencji prawdopodobne jest, że duża liczba recesywnych szkodliwych alleli przyczynia się do depresji inbredowej, która objawia się negatywnymi skutkami ROH rozłożonymi na wiele loci.

Regionalna depresja inbredowa została skonceptualizowana i przetestowana przy użyciu dwóch binarnych predyktorów stanu ROH. Jeden z predyktorów określał ilościowo status ROH allelu A (w ROH = 1, nie w ROH = 0), podczas gdy drugi określał ilościowo status ROH allelu B. a Rozkład wielkości efektów dla efektów stanu ROH pod kątem SNP. b Dystrybucja P-wartości dla efektów statusu SNP-wise ROH. Żółte histogramy pokazujące pozytywne skutki są nałożone na fioletowe histogramy pokazujące negatywne skutki, aby podkreślić znacznie większy odsetek negatywnych skutków statusu ROH niż oczekiwano przypadkowo. C Działka Manhattan o statusie ROH P-wartości w całym genomie. Linia kropkowana oznacza próg istotności dla całego genomu dla korekty Bonferroniego, który został oparty na efektywnej liczbie testów przy uwzględnieniu nierównowagi sprzężeń.

GWAS ujawnił znaczące efekty ROH w całym genomie w siedmiu regionach na chromosomach 3 (dwa regiony), 10, 14, 18, 19 i 23 (ryc. 4c i tabela uzupełniająca 5). W pięciu z tych regionów status ROH dla jednego z alleli wiązał się z negatywnym wpływem na przeżycie, prawdopodobnie spowodowanym przez stosunkowo silnie szkodliwe allele recesywne. ROH w dwóch dalszych regionach na chromosomach 3 i 19 były związane ze zwiększonym prawdopodobieństwem przeżycia, prawdopodobnie z powodu haplotypów o pozytywnym wpływie na przeżycie. To explore the genomic regions with large ROH effects further, we quantified the ROH density and SNP heterozygosity in 2 Mb windows around the top GWAS hits (Supplementary Fig. 8). Strongly deleterious recessive alleles might be expected to occur in regions of elevated heterozygosity where they are rarely expressed in their homozygous state. Heterozygosity was higher than average around the top SNPs on chromosomes 10, 14, 18 and 23, and ROH frequency was lower around the top SNPs on chromosomes 10, 18, 19 and 23, but overall, but we did not observe a convincing pattern of genetic diversity across the five regions harbouring strongly deleterious mutations (Supplementary Fig. 8).


THE GENETIC INTERPRETATION OF INBREEDING DEPRESSION AND OUTBREEDING DEPRESSION

Inbreeding with close relatives and outbreeding with members of distant populations can both result in deleterious shifts in the means of fitness-related characters, most likely for very different reasons. Such processes often occur simultaneously and have important implications for the evolution of mating systems, dispersal strategies, and speciation. They are also relevant to the design of breeding strategies for captive populations of endangered species. A general expression is presented for the expected phenotype of an individual under the joint influence of inbreeding and crossbreeding. This expression is a simple function of the inbreeding coefficient, of source and hybridity indices of crossbreeding, and of specific forms of gene action. Application of the model may be of use in identifying the mechanistic bases for a number of evolutionary phenomena such as the shift from outbreeding enhancement to outbreeding depression that occurs with population divergence.

Słowa kluczowe: Inbreeding depression outbreeding depression.


MATERIAŁY I METODY

Study species and populations

Witheringia solanacea is a small shrub that extends from southern Mexico and the Caribbean to South America (D𠆚rcy, 1973). It possesses the gametophytic SI system characteristic of the Solanaceae, where allele-specific S-RNases expressed in the style cause the degradation of RNA, and therefore the death of pollen tubes bearing the cognate S-allele (McClure et al., 1990). The floral biology of W. solanacea is described in detail by Bohs (2000). Its flowers are pollinated by small bees and its fleshy fruits are bird-dispersed. Witheringia solanacea also reproduces prolifically by vegetative reproduction in gardens and along trailsides. Cuttings were collected in the field from Costa Rican populations and maintained in the greenhouse at Colby College. Populations and locations have been described by Stone and Pierce (2005) and Stone et al. (2006). Plants were sampled from populations in three geographic regions. Self-incompatible plants were sampled from large populations in the Las Cruces region, at 1180� m a.s.l. in southwestern Costa Rica, and the Monteverde region in northwestern Costa Rica, extending from 1100 m elevation in the San Luis Valley to 1500 m a.s.l. in the village of Monteverde. The SC individuals came from the very small population at Vara Blanca at 1360 m a.s.l. in central Costa Rica and from the undescribed but morphologically distinct variety at lower elevations in the Monteverde region. Treatments were carried out on seven SI individuals from Las Cruces and 13 from Monteverde, in addition to the two strongly SC individuals available from Vara Blanca and three from Monteverde. The low sample size of SC plants was a consequence of the relative scarcity of the SC phenotype in Monteverde and the tiny overall size of the population in Vara Blanca, which over a decade of monitoring has never been found to contain more than six individuals.

Pollen chase experiment and pollen tube growth

For each trial, we conducted 3𠄶 pairs of SO and OO treatments over a period of 1 week to 10 days. During the summers of 2004�, 48 trials were carried out: seven on SC plants, 14 on Las Cruces plants, and 27 on Monteverde plants. Pollen was collected in clean vials and applied using clean toothpicks to styles of unopened flowers, 24 h before anthesis. Buds at this stage can be identified because they are still tightly closed but have developed the green splotches that decorate the corolla of mature flowers. Pairs of buds were chosen on each recipient, the bud for the SO treatment receiving self-pollen, and the bud for the OO treatment receiving outcross pollen. Twenty-four hours later, outcross pollen from a single compatible donor was applied to both flowers. Previous work in our laboratory has shown that although bud self-pollinations produce fewer pollen tubes at the base of the style than do bud outcross-pollinations, both types of pollinations produce tubes that grow past midstyle at 24 h and reach the base of the style by 48 h. Therefore, we assume that 24 h priority is sufficient to ensure that bud self-pollen tubes reach the base of the style before the subsequent outcross pollen tubes do. In total, 852 pollinations were done, half of which were bud pollinations. Fruits were allowed to ripen, and seeds were counted.

Germination and genotyping

To compare germination rates among treatments for SI populations, we planted seeds from fruits representing all available mothers and cross types. In most instances, 20 seeds were planted per cross, but in some cases all seeds per fruit were planted. We planted five seeds per cell in a 128-cell flat filled with Metro-Mix 200 (Sun-Gro Horticulture, Vancouver, British Columbia, Canada), alternating the position of cells occupied by seeds from SO and OO fruits. Seeds were covered with a fine layer of vermiculite, and the flats were placed in a mist bench under 12-h light/12-h dark in the greenhouse at Colby College. Liquid fertilizer was applied weekly once initial sprouts appeared. Germination was recorded at 6 wk, at which time seedlings were transplanted to individual cells and randomly placed on the bench. Seedlings were harvested by clipping with scissors at ground level at 12 wk and air dried.

To detect the level of self-fertilization resulting from the SO treatment, we used five microsatellite loci to genotype progeny and parental plants. We genotyped 73 progeny from 13 SO pollinations on eight maternal plants. Microsatellite-enriched libraries were developed by Craig Newton of ATG genetics (Vancouver, Washington. USA). We amplified inserts using universal m13 primers, sequenced the inserts using an ABI 3130 genetic analyzer (Applied Biosystems, Foster City, California, USA), and designed primers using the program Primer3 (Rozen and Skaletsky, 2000). Primer sequences appear in Table 1 .

Tabela 1

Primer sequences for microsatellite genotyping of Witheringia solanacea.

NazwaSequenceTm (ଌ)Product length (bp)Alleles in sample
WsolgataA6Lctgctacccatggctcaact60.28185�6
WsolgataA6Rttttctcggttgcaatggtt60.48
WsolcaA3Lgcaaaatacagtcaacacaatgaa59.10244�2
WsolcaA3Rgctcacgtggtgtttgtaga57.30
WsolcaE1Lcgatccacatcagctgaaaa59.80187�3
WsolcaE1Racccaggaattggggtaaga60.55
WsolcaE2Lgcggatccaggacatgaata60.83209�3
WsolcaE2Rctcctgcgacctgtctgttt60.44
WsolcaE9Ltccctcattggtaagggatg59.74154�4
WsolcaE9Rcgaccagtgctagctgacaa60.20

We extracted genomic DNA using the Qiagen (Germantown, Maryland, USA) DNeasy Plant Mini Kit on 40 mg dried leaf material, using dry ice to keep the tissue brittle for grinding in the Qiagen tissue lyser. PCR was carried out in 25 μL volumes in standard buffer with 1.5 mM MgCl2, 0.8 mM dNTPs, 0.5 μM each primer, 2 U Taq polymerase, and 10 ng genomic DNA. In each reaction, the left primer was fluorescently tagged with 6-FAM. A touchdown PCR program was used, with the annealing temperature decreasing from 60ଌ to 50ଌ by 0.5° each cycle for the first 20 cycles and kept at 50ଌ thereafter. Other PCR conditions were an initial denaturation at 95ଌ for 2.5 min and 35 cycles with 95ଌ for 20 s, annealing for 30 s, and extension at 72ଌ for 30 s with a final extension at 72ଌ for 10 min. PCR products were suspended in deionized formamide with ROX-500 size standard (Applied Biosystems) and run under standard conditions on an ABI 3130 genetic analyzer. Peaks were visualized using GeneScan and scored manually.

Analiza danych

For the two SI populations, we used a two-way ANOVA to compare fruit and seed set of SO and OO treatments, with population as a random factor and treatment as a fixed factor. Maternal plant was nested within population. Treatment and the population × treatment interaction were tested over treatment × maternal plant nested within the population. To meet assumptions of ANOVA, proportion fruit set was arcsine-transformed, and seed number per plant per treatment was averaged and square-root transformed. The low number of available SC plants made it impossible to evaluate assumptions of parametric tests. For analyses involving SC plants, we used a Wilcoxon’s matched pairs signed rank test for paired comparisons, a Mann–Whitney test for unpaired comparisons, and Kruskal–Wallis tests for comparisons involving all three populations. Nonparametric tests were also used for germination data. Mann–Whitney tests were done by hand, and the program Stata 10.1 (Stata-Corp, College Station, Texas, USA) was used for all other analyses. The cumulative embryonic fitness decline associated with self-precedence was calculated for each individual according to the formula: δ = 1 − (wsf/wz · wSS/wos), gdzie wsf = proportion of SO pollinations producing fruit, wz = proportion of OO pollinations producing fruit, wSS = average seed number resulting from SO pollinations, wos = average seed number resulting from OO pollinations.

To estimate the selfing rate for SO fruits, we calculated the probability, at each locus, that each offspring was a product of self-fertilization. If any locus revealed a definitive outcrossing event, the progeny was recorded as an out-cross. If no loci revealed definitive outcrossing, the likelihood of selfing was found by multiplying the probabilities across loci.

Pollen tube data, together with selfing rate estimates, allowed us to account for residual SI in the estimate of embryonic inbreeding depression. Bud self-pollination of SI plants from the Monteverde population yielded an average of 37 pollen tubes at the base of the style, whereas bud self-pollination of SI plants from Las Cruces yielded an average of only 13 pollen tubes at the base of the style (Stone et al., 2006). The number of pollen tubes at the base of the style after bud self-pollinations provides the maximum number of selfed seeds that could be expected under bud self-pollination. Any seeds in excess of that expectation should be due to the outcross pollination done on the second day of the pollen chase experiment. An expected selfing rate can therefore be obtained by comparing the number of self-pollen tubes with the total number of seeds. The observed selfing rate of surviving progeny as obtained by microsatellite genotyping was compared with the expected rate to estimate the relative postzygotic fitness of selfed progeny.


What impact has recent inbreeding had on the genetic diversity of domestic dogs?

Research published today in Canine Genetics and Epidemiology investigated the rate of inbreeding in domestic dog breeds recognized by The Kennel Club. Here, Tom Lewis explains more.

The term ‘inbreeding’ is widely associated with severe physiological (and in humans, mental) impairment as a consequence of parents being closely related. As a result, incestuous relationships are a widespread cultural taboo, with laws against incestuous marriages, at least of first degree relatives, almost universally present throughout the world.

However, it is actually very difficult to avoid any degree of relationship between two parents. In part this is due to simple mathematics – the number of ancestors increases exponentially with each generation further back (two parents, four grand-parents, eight great-grand-parents) meaning that it is inevitable there will be some degree of common ancestry if we go back far enough.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

That relatives resemble each other is a central tenet of genetics. Therefore, if we select breeding animals that resemble each other with respect to a particular trait, then these individuals will on average be more closely related than if mating was random.

This means that selection will lead to some degree of inbreeding. Consequently, rather than attempting to avoid any inbreeding in domestic animal populations at all, a more useful strategy is to manage the loss of genetic diversity (rate of inbreeding) to within sustainable levels.

Calculating the rate of inbreeding

The domestic dog shows a greater variety in appearance and behavior than any other domestic species. Many distinct breeds were formed and are maintained by closed registries which have led to the widespread belief that pedigree dogs are very inbred.

Crucially however, the rigorous recording of pedigree data provides large datasets from which genetic parameters and historical trends can be determined, and this information used to guide future breeding strategies.

The rates of inbreeding calculated in all 215 domestic dog breeds recognized by the Kennel Club over the period 1980 to 2014 form the results central to a study recently published in Canine Genetics and Epidemiology. Although the precise profile of rate of loss of genetic diversity is unique for each breed, the study did determine some broad trends.

What did we find?

There was a general contraction of within-breed genetic diversity in the 1980s and 1990s, with the overall rate of inbreeding at a level at which detrimental effects, such as inbreeding depression, would be expected to be observed. However, since the turn of the century the rate of inbreeding has tended to decline across breeds, implying breeders have taken steps to conserve genetic diversity.

Interestingly this general decline in the rate of inbreeding coincides with the relaxation of the UK’s quarantine laws. This suggests that breeders may have taken the opportunity provided by new laws easing travel restrictions for dogs to slow the erosion of genetic diversity, or even re-introduce some genetic variation, through more widespread use of non-UK animals in breeding.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size (as judged by mean number of Kennel Club registrations). This implies that it is possible to conserve genetic diversity via a sustainable rate of inbreeding in small populations, perhaps through judicious use of migrant animals for breeding to provide an injection of genetic diversity to the population.

The existence of popular sires, or male parents, was observed in virtually all pedigree dog breeds in the study. The repeated use of prolific breeding males is both often a feature of selection and a contributor to a high rate of inbreeding, and is typical in breeding practices of almost all domestic mammal species.

Intense selection in males

The much greater reproductive capacity of males compared to females means more intense selection can be applied to males, and the few selected then make a far greater individual genetic contribution to future generations.

While this results in widespread dissemination of genes influencing ‘sought after’ traits (the response to selection), it also makes such males much more likely to be a common ancestor to all breeding animals in subsequent generations, increasing the rate of inbreeding.

The challenge remains, for the dog as for other domestic species, to achieve sufficient response to selection (for traits related to health, temperament, and so on) at a rate of loss of genetic diversity which is sustainable.



Uwagi:

  1. Amoll

    Zanim zaczniesz szukać pracy, zapoznaj się z rekomendacjami pracowników na temat ich pracodawców na naszej stronie. I dopiero wtedy zdecyduj, czy zaproponować swoją propozycję tej czy innej organizacji. Poznaj różne rekomendacje i dokonaj wyboru.

  2. Roselyn

    Zgadzam się, to świetna informacja.

  3. Marshall

    Uważam, że nie masz racji. Mogę bronić pozycji. Napisz do mnie na PW.

  4. Pepillo

    Przepraszam za ingerowanie ... Mogę znaleźć drogę do tego pytania. Można omówić.

  5. Pili

    Usprawiedliwienie, pomyślałem i odepchnąłem pytanie



Napisać wiadomość